Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Lrrc7'

600846

Institutional Source

Beutler Lab

Gene Symbol

Lrrc7

Ensembl Gene

ENSMUSG00000028176

Gene Name

leucine rich repeat containing 7

Synonyms

densin

MMRRC Submission

Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene?

Possibly essential (E-score: 0.749) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

158082891-158562221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158160487 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1206 (S1206P)

Ref Sequence

ENSEMBL: ENSMUSP00000142498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]

Predicted Effect

probably damaging
Transcript: ENSMUST00000106044
AA Change: S1206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: S1206P

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1349	1378	2e-11	BLAST
PDZ	1460	1540	1.33e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199890
AA Change: S1206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: S1206P

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	9e-6	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1328	1364	1e-15	BLAST
low complexity region	1374	1387	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200137
AA Change: S1206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: S1206P

Domain	Start	End	E-Value	Type
LRR	52	69	7.6e-1	SMART
LRR	73	92	4.2e-1	SMART
LRR	96	115	3.4e-1	SMART
LRR	142	164	1.8e-1	SMART
LRR	165	184	1.5e-1	SMART
LRR	188	207	2e-2	SMART
LRR	211	233	1.3e-1	SMART
LRR	234	257	1.7e-1	SMART
LRR	257	276	1e0	SMART
LRR	280	299	3.1e-2	SMART
LRR	303	322	6.6e-1	SMART
LRR	326	345	2.1e-1	SMART
LRR	372	391	1.2e-1	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1302	1331	2e-11	BLAST
PDZ	1413	1493	6.4e-22	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Lrrc7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Lrrc7	APN	3	158187010	missense	probably benign	0.07
IGL00644:Lrrc7	APN	3	158202368	nonsense	probably null
IGL00822:Lrrc7	APN	3	158185474	missense	probably damaging	0.99
IGL00927:Lrrc7	APN	3	158161090	missense	possibly damaging	0.94
IGL00946:Lrrc7	APN	3	158161356	missense	probably benign	0.07
IGL00948:Lrrc7	APN	3	158161557	missense	probably damaging	1.00
IGL01838:Lrrc7	APN	3	158185463	missense	probably damaging	1.00
IGL01874:Lrrc7	APN	3	158240443	splice site	probably benign
IGL02514:Lrrc7	APN	3	158160292	missense	probably damaging	0.96
IGL02545:Lrrc7	APN	3	158185374	splice site	probably benign
IGL02665:Lrrc7	APN	3	158161105	missense	probably damaging	0.99
IGL03129:Lrrc7	APN	3	158161059	missense	probably benign	0.02
N/A:Lrrc7	UTSW	3	158160340	missense	probably benign
R0021:Lrrc7	UTSW	3	158160661	missense	probably damaging	1.00
R0041:Lrrc7	UTSW	3	158164260	splice site	probably benign
R0255:Lrrc7	UTSW	3	158160838	nonsense	probably null
R0278:Lrrc7	UTSW	3	158179795	missense	possibly damaging	0.96
R0409:Lrrc7	UTSW	3	158161426	missense	possibly damaging	0.59
R0612:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R0866:Lrrc7	UTSW	3	158164266	splice site	probably benign
R1077:Lrrc7	UTSW	3	158161143	missense	probably damaging	1.00
R1103:Lrrc7	UTSW	3	158148706	splice site	probably benign
R1157:Lrrc7	UTSW	3	158160255	missense	probably damaging	1.00
R1187:Lrrc7	UTSW	3	158160402	missense	probably damaging	1.00
R1301:Lrrc7	UTSW	3	158135331	missense	probably benign	0.20
R1433:Lrrc7	UTSW	3	158177306	missense	probably damaging	1.00
R1450:Lrrc7	UTSW	3	158187044	missense	possibly damaging	0.62
R1595:Lrrc7	UTSW	3	158177277	nonsense	probably null
R1659:Lrrc7	UTSW	3	158161408	missense	probably damaging	1.00
R1693:Lrrc7	UTSW	3	158084533	missense	possibly damaging	0.95
R1774:Lrrc7	UTSW	3	158160292	missense	possibly damaging	0.88
R2273:Lrrc7	UTSW	3	158187059	missense	probably damaging	1.00
R2276:Lrrc7	UTSW	3	158179792	missense	probably damaging	1.00
R2302:Lrrc7	UTSW	3	158135244	missense	probably damaging	0.99
R2326:Lrrc7	UTSW	3	158170661	missense	probably damaging	1.00
R2371:Lrrc7	UTSW	3	158161060	missense	probably damaging	0.99
R2383:Lrrc7	UTSW	3	158163956	missense	probably benign
R2679:Lrrc7	UTSW	3	158175108	nonsense	probably null
R2698:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R2858:Lrrc7	UTSW	3	158161725	missense	probably damaging	0.99
R3758:Lrrc7	UTSW	3	158163965	missense	probably damaging	1.00
R3791:Lrrc7	UTSW	3	158163956	missense	probably benign
R3805:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3806:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3807:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3892:Lrrc7	UTSW	3	158160696	missense	probably benign	0.08
R3912:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3913:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3963:Lrrc7	UTSW	3	158160405	missense	probably damaging	1.00
R4665:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4666:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4671:Lrrc7	UTSW	3	158202495	critical splice acceptor site	probably null
R4688:Lrrc7	UTSW	3	158148605	missense	probably damaging	1.00
R4725:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4726:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4728:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4783:Lrrc7	UTSW	3	158127213	critical splice donor site	probably null
R4867:Lrrc7	UTSW	3	158161005	missense	probably damaging	1.00
R4907:Lrrc7	UTSW	3	158161240	missense	probably damaging	1.00
R5032:Lrrc7	UTSW	3	158181580	missense	possibly damaging	0.85
R5107:Lrrc7	UTSW	3	158161896	missense	probably damaging	1.00
R5295:Lrrc7	UTSW	3	158170739	missense	probably damaging	1.00
R5348:Lrrc7	UTSW	3	158175326	missense	probably benign	0.02
R5468:Lrrc7	UTSW	3	158318436	missense	probably damaging	1.00
R5778:Lrrc7	UTSW	3	158170743	missense	probably damaging	1.00
R5897:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R6179:Lrrc7	UTSW	3	158353432	missense	probably damaging	0.99
R6312:Lrrc7	UTSW	3	158160609	missense	probably benign	0.04
R6313:Lrrc7	UTSW	3	158160736	missense	probably damaging	1.00
R6366:Lrrc7	UTSW	3	158135375	missense	probably benign	0.04
R6389:Lrrc7	UTSW	3	158185426	missense	probably damaging	1.00
R6638:Lrrc7	UTSW	3	158135303	missense	probably benign	0.20
R6956:Lrrc7	UTSW	3	158289031	missense	probably benign	0.02
R6969:Lrrc7	UTSW	3	158156913	missense	probably benign	0.19
R7073:Lrrc7	UTSW	3	158127247	missense	probably damaging	1.00
R7313:Lrrc7	UTSW	3	158160474	missense	probably damaging	1.00
R7365:Lrrc7	UTSW	3	158198161	missense	probably damaging	1.00
R7398:Lrrc7	UTSW	3	158291958	nonsense	probably null
R7403:Lrrc7	UTSW	3	158148674	nonsense	probably null
R7407:Lrrc7	UTSW	3	158135241	missense	probably damaging	1.00
R7427:Lrrc7	UTSW	3	158198141	missense	probably benign	0.06
R7453:Lrrc7	UTSW	3	158185409	missense	probably benign	0.00
R7461:Lrrc7	UTSW	3	158187020	missense	probably benign	0.00
R7872:Lrrc7	UTSW	3	158353462	missense	probably damaging	0.99
R8215:Lrrc7	UTSW	3	158209750	missense	probably benign
R8367:Lrrc7	UTSW	3	158202370	missense	possibly damaging	0.80
R8867:Lrrc7	UTSW	3	158161884	missense	probably damaging	0.99
R8880:Lrrc7	UTSW	3	158161744	missense	probably damaging	0.99
R8941:Lrrc7	UTSW	3	158163956	missense	probably benign
R8958:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCCAGTCTGCCGGCATTTTG -3'
(R):5'- CATGTTCAGAAGGGTCAGTGAGC -3'

Sequencing Primer
(F):5'- GCATTTTGCCACAGCTCTC -3'
(R):5'- TGACAGGTATGGCCGAGC -3'

Posted On

2019-11-26