Incidental Mutation 'R7807:Sdcbp'
ID600847
Institutional Source Beutler Lab
Gene Symbol Sdcbp
Ensembl Gene ENSMUSG00000028249
Gene Namesyndecan binding protein
Synonymssyntenin-1, syndecan interacting protein, syntenin, Sycl, MDA-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location6365650-6408423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6393688 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 269 (T269A)
Ref Sequence ENSEMBL: ENSMUSP00000029912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000153861] [ENSMUST00000175769]
Predicted Effect probably benign
Transcript: ENSMUST00000029910
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000029912
AA Change: T269A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249
AA Change: T269A

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103008
AA Change: T268A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249
AA Change: T268A

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153861
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175769
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice heterozygous for a conditional allele activated in neurons exhibit abnormal dendrite morphology and reduced mEPSC frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Sdcbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Sdcbp APN 4 6392953 nonsense probably null
R0158:Sdcbp UTSW 4 6379042 missense possibly damaging 0.81
R1066:Sdcbp UTSW 4 6385120 missense probably damaging 0.98
R1115:Sdcbp UTSW 4 6377143 critical splice donor site probably null
R1353:Sdcbp UTSW 4 6381057 missense probably damaging 0.99
R2006:Sdcbp UTSW 4 6386536 missense probably benign 0.23
R4879:Sdcbp UTSW 4 6381056 missense possibly damaging 0.93
R4979:Sdcbp UTSW 4 6378980 nonsense probably null
R5034:Sdcbp UTSW 4 6393118 critical splice donor site probably null
R5072:Sdcbp UTSW 4 6393019 missense probably benign 0.07
R6307:Sdcbp UTSW 4 6385059 missense probably benign 0.06
R6329:Sdcbp UTSW 4 6381064 missense probably benign 0.04
R7483:Sdcbp UTSW 4 6393089 missense possibly damaging 0.95
R7665:Sdcbp UTSW 4 6385144 missense probably benign 0.11
R7722:Sdcbp UTSW 4 6385063 missense possibly damaging 0.93
R7729:Sdcbp UTSW 4 6378985 missense probably benign 0.06
R8025:Sdcbp UTSW 4 6393022 missense probably benign 0.09
R8941:Sdcbp UTSW 4 6393661 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGGACTTTTGGTCAGTACCTTC -3'
(R):5'- ACAGGCAAGCAATCCGTCAG -3'

Sequencing Primer
(F):5'- GTCAGTACCTTCAACTTTGTTACTAG -3'
(R):5'- GTCAGGAACCACCATGACTAGATTTC -3'
Posted On2019-11-26