Incidental Mutation 'R7807:Clock'
ID600853
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Namecircadian locomotor output cycles kaput
Synonyms5330400M04Rik, bHLHe8, KAT13D
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76209868-76304792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76243135 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 273 (N273K)
Ref Sequence ENSEMBL: ENSMUSP00000074656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
PDB Structure
Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000075159
AA Change: N273K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: N273K

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202122
AA Change: N273K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: N273K

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202651
AA Change: N273K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: N273K

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8225:Clock UTSW 5 76241912 missense probably damaging 0.99
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATGTTCCACTAGTTACACTACAGAC -3'
(R):5'- TTTTGTATCACCAGCTGGCTAC -3'

Sequencing Primer
(F):5'- CAGACAACATTCATTTGGAGAATGG -3'
(R):5'- ACCAGCTGGCTACACTTGTG -3'
Posted On2019-11-26