Incidental Mutation 'R7807:Sh2d4a'
ID 600864
Institutional Source Beutler Lab
Gene Symbol Sh2d4a
Ensembl Gene ENSMUSG00000053886
Gene Name SH2 domain containing 4A
Synonyms SH2A, 2210402M20Rik
MMRRC Submission 045862-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 68729219-68800351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 68735033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 51 (S51A)
Ref Sequence ENSEMBL: ENSMUSP00000070825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066594]
AlphaFold Q9D7V1
Predicted Effect probably benign
Transcript: ENSMUST00000066594
AA Change: S51A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070825
Gene: ENSMUSG00000053886
AA Change: S51A

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
SH2 313 396 2.5e-22 SMART
Predicted Effect
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display normal T cell development, homeostasis, proliferation, and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 C A 9: 21,447,276 (GRCm39) T146K probably benign Het
Alms1 T A 6: 85,599,958 (GRCm39) S1595T possibly damaging Het
Ankrd44 A T 1: 54,831,635 (GRCm39) I56N probably damaging Het
Anln C A 9: 22,272,176 (GRCm39) V648F probably damaging Het
Arhgap29 A G 3: 121,807,981 (GRCm39) D1053G probably benign Het
Baalc T C 15: 38,797,412 (GRCm39) S68P probably benign Het
Begain T C 12: 109,004,856 (GRCm39) D52G probably damaging Het
Blmh A G 11: 76,837,040 (GRCm39) I41V probably benign Het
Bpifc T A 10: 85,812,114 (GRCm39) I365F possibly damaging Het
C2 G T 17: 35,095,347 (GRCm39) S199R possibly damaging Het
Ccbe1 T A 18: 66,199,828 (GRCm39) H298L probably damaging Het
Ccdc112 T A 18: 46,423,826 (GRCm39) K304I probably damaging Het
Ccdc15 T C 9: 37,226,678 (GRCm39) E432G probably benign Het
Cdh13 T A 8: 119,010,594 (GRCm39) M1K probably null Het
Cipc T C 12: 87,008,899 (GRCm39) S253P possibly damaging Het
Clcn1 A G 6: 42,287,282 (GRCm39) probably null Het
Clock A T 5: 76,390,982 (GRCm39) N273K probably benign Het
Cyp19a1 T C 9: 54,074,126 (GRCm39) D476G probably benign Het
Dnaaf9 T C 2: 130,552,785 (GRCm39) K1092E probably damaging Het
Dnah7b A G 1: 46,253,527 (GRCm39) I1811V probably benign Het
Fat1 C A 8: 45,495,010 (GRCm39) T4091K probably damaging Het
Gm10340 T A 14: 14,826,724 (GRCm39) N64K probably damaging Het
Hectd1 G A 12: 51,792,171 (GRCm39) R2523C probably damaging Het
Hgf A G 5: 16,782,009 (GRCm39) H244R probably damaging Het
Hgs G T 11: 120,370,760 (GRCm39) A567S probably damaging Het
Igdcc4 T C 9: 65,041,077 (GRCm39) V1036A probably benign Het
Keg1 G A 19: 12,691,998 (GRCm39) probably null Het
Klhl8 A T 5: 104,023,932 (GRCm39) L156Q probably damaging Het
Lmln T C 16: 32,927,501 (GRCm39) Y521H probably benign Het
Lrrc7 A G 3: 157,866,124 (GRCm39) S1206P probably damaging Het
Mad1l1 T A 5: 140,074,541 (GRCm39) I550F probably benign Het
Marf1 C T 16: 13,971,753 (GRCm39) W28* probably null Het
Mfsd11 T G 11: 116,754,733 (GRCm39) S215A probably benign Het
Mpped2 C A 2: 106,575,085 (GRCm39) H57N possibly damaging Het
Mslnl A G 17: 25,965,751 (GRCm39) M542V probably benign Het
Myh6 G T 14: 55,179,897 (GRCm39) H1903Q probably damaging Het
Neo1 T C 9: 58,897,777 (GRCm39) T60A probably benign Het
Npm2 T A 14: 70,889,947 (GRCm39) probably null Het
Or5b123 C A 19: 13,597,285 (GRCm39) T210K probably damaging Het
Or5d20-ps1 T C 2: 87,931,909 (GRCm39) S141G probably benign Het
Or7a39 T A 10: 78,715,043 (GRCm39) S12R probably benign Het
Pax9 A T 12: 56,743,850 (GRCm39) I166F possibly damaging Het
Pcsk9 A G 4: 106,321,092 (GRCm39) S6P possibly damaging Het
Pikfyve A G 1: 65,309,101 (GRCm39) Y1893C probably damaging Het
Pirb T C 7: 3,722,864 (GRCm39) T43A possibly damaging Het
Pou3f1 A G 4: 124,552,074 (GRCm39) D192G possibly damaging Het
Pus3 C G 9: 35,478,021 (GRCm39) R418G probably damaging Het
Rexo1 C T 10: 80,385,970 (GRCm39) V363I probably benign Het
Sdcbp A G 4: 6,393,688 (GRCm39) T269A probably damaging Het
Sele T C 1: 163,881,462 (GRCm39) V523A probably benign Het
Serpinb8 T A 1: 107,532,457 (GRCm39) M183K probably damaging Het
Siglec15 A G 18: 78,090,696 (GRCm39) S201P probably damaging Het
Slc10a5 C T 3: 10,400,529 (GRCm39) V44I probably benign Het
Slc16a13 A G 11: 70,111,388 (GRCm39) V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 (GRCm39) R184W probably damaging Het
Slc35f5 T A 1: 125,512,278 (GRCm39) D359E probably damaging Het
Slc3a1 A G 17: 85,371,371 (GRCm39) E641G probably benign Het
Slf1 T C 13: 77,194,823 (GRCm39) D834G probably damaging Het
Spata31f1e A C 4: 42,793,885 (GRCm39) H82Q probably benign Het
Stim1 T C 7: 102,076,348 (GRCm39) I433T probably damaging Het
Stra6 T A 9: 58,057,444 (GRCm39) I418K probably damaging Het
Tanc2 A G 11: 105,758,480 (GRCm39) N747S probably benign Het
Tet2 T C 3: 133,192,302 (GRCm39) T711A possibly damaging Het
Trpm6 T C 19: 18,807,220 (GRCm39) I988T probably benign Het
Ttc41 T A 10: 86,612,495 (GRCm39) I1256N probably benign Het
Uba2 T C 7: 33,862,638 (GRCm39) D100G possibly damaging Het
Vmn1r43 A G 6: 89,847,219 (GRCm39) I89T probably benign Het
Vmn2r58 T A 7: 41,521,910 (GRCm39) Y62F probably benign Het
Ylpm1 C T 12: 85,060,855 (GRCm39) Q428* probably null Het
Zcrb1 T C 15: 93,289,002 (GRCm39) D88G probably damaging Het
Zmym1 A C 4: 126,941,667 (GRCm39) I907S probably damaging Het
Other mutations in Sh2d4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Sh2d4a APN 8 68,782,018 (GRCm39) splice site probably null
R0078:Sh2d4a UTSW 8 68,734,973 (GRCm39) missense probably damaging 0.98
R0608:Sh2d4a UTSW 8 68,799,346 (GRCm39) missense possibly damaging 0.92
R0701:Sh2d4a UTSW 8 68,783,747 (GRCm39) missense probably damaging 1.00
R0924:Sh2d4a UTSW 8 68,787,775 (GRCm39) missense probably damaging 1.00
R0930:Sh2d4a UTSW 8 68,787,775 (GRCm39) missense probably damaging 1.00
R1690:Sh2d4a UTSW 8 68,747,101 (GRCm39) missense probably benign 0.00
R1744:Sh2d4a UTSW 8 68,783,807 (GRCm39) missense possibly damaging 0.93
R1864:Sh2d4a UTSW 8 68,781,967 (GRCm39) missense probably benign 0.38
R2011:Sh2d4a UTSW 8 68,799,394 (GRCm39) missense probably benign 0.02
R2014:Sh2d4a UTSW 8 68,783,735 (GRCm39) missense probably damaging 1.00
R2172:Sh2d4a UTSW 8 68,749,316 (GRCm39) missense probably benign 0.00
R4010:Sh2d4a UTSW 8 68,787,799 (GRCm39) missense probably damaging 1.00
R4542:Sh2d4a UTSW 8 68,799,394 (GRCm39) missense probably benign 0.01
R5522:Sh2d4a UTSW 8 68,749,349 (GRCm39) missense probably benign 0.38
R6627:Sh2d4a UTSW 8 68,746,970 (GRCm39) missense probably damaging 1.00
R7482:Sh2d4a UTSW 8 68,749,328 (GRCm39) missense probably benign
R7955:Sh2d4a UTSW 8 68,781,907 (GRCm39) missense probably benign 0.10
R8725:Sh2d4a UTSW 8 68,798,695 (GRCm39) missense probably damaging 1.00
R8727:Sh2d4a UTSW 8 68,798,695 (GRCm39) missense probably damaging 1.00
R9364:Sh2d4a UTSW 8 68,747,018 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGTTTCCAAGAACTTCTGC -3'
(R):5'- GTGTGAGCAGATGCAGACTTC -3'

Sequencing Primer
(F):5'- TCCAAGAACTTCTGCTGTAGG -3'
(R):5'- GAGCAGATGCAGACTTCCACTTG -3'
Posted On 2019-11-26