Incidental Mutation 'R7807:AB124611'
ID600866
Institutional Source Beutler Lab
Gene Symbol AB124611
Ensembl Gene ENSMUSG00000057191
Gene NamecDNA sequence AB124611
SynonymsLOC382062, HIDE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21526176-21545333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21535980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 146 (T146K)
Ref Sequence ENSEMBL: ENSMUSP00000083547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076326] [ENSMUST00000086361] [ENSMUST00000173769]
Predicted Effect probably benign
Transcript: ENSMUST00000076326
SMART Domains Protein: ENSMUSP00000075665
Gene: ENSMUSG00000057191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086361
AA Change: T146K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083547
Gene: ENSMUSG00000057191
AA Change: T146K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IG 28 121 1e-12 BLAST
transmembrane domain 127 149 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173769
SMART Domains Protein: ENSMUSP00000134056
Gene: ENSMUSG00000057191

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IG 28 121 8e-13 BLAST
low complexity region 177 192 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in AB124611
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:AB124611 APN 9 21539894 splice site probably benign
IGL01566:AB124611 APN 9 21535989 missense possibly damaging 0.46
IGL01571:AB124611 APN 9 21539081 splice site probably benign
IGL02428:AB124611 APN 9 21528925 missense possibly damaging 0.66
R6610:AB124611 UTSW 9 21526265 start codon destroyed probably benign 0.01
R7284:AB124611 UTSW 9 21539104 missense probably benign 0.27
R8300:AB124611 UTSW 9 21526265 start codon destroyed probably null 0.01
R8417:AB124611 UTSW 9 21529085 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAAGTTCCCAGGACCACC -3'
(R):5'- GCCTTGATGACAGGATGGAG -3'

Sequencing Primer
(F):5'- AGACACTTGGCGAGGTGTC -3'
(R):5'- TAGCACAGTGCCTGCAC -3'
Posted On2019-11-26