Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Stra6'

600871

Institutional Source

Beutler Lab

Gene Symbol

Stra6

Ensembl Gene

ENSMUSG00000032327

Gene Name

stimulated by retinoic acid gene 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58063788-58153996 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58150161 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 418 (I418K)

Ref Sequence

ENSEMBL: ENSMUSP00000034880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000170397]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034880
AA Change: I418K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327
AA Change: I418K

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085677
AA Change: I418K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327
AA Change: I418K

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	41	658	1.9e-248	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167479
AA Change: I418K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327
AA Change: I418K

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170397
AA Change: I418K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327
AA Change: I418K

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Stra6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Stra6	APN	9	58152571	missense	probably benign	0.01
IGL01885:Stra6	APN	9	58141148	missense	probably damaging	1.00
IGL02219:Stra6	APN	9	58140469	missense	probably benign	0.18
IGL02550:Stra6	APN	9	58150083	missense	possibly damaging	0.95
IGL02745:Stra6	APN	9	58152038	missense	probably damaging	1.00
IGL02999:Stra6	APN	9	58135113	missense	probably benign	0.19
R0034:Stra6	UTSW	9	58151469	splice site	probably null
R0070:Stra6	UTSW	9	58152615	splice site	probably benign
R0070:Stra6	UTSW	9	58152615	splice site	probably benign
R0281:Stra6	UTSW	9	58145489	missense	probably benign	0.11
R0387:Stra6	UTSW	9	58153183	missense	probably benign	0.13
R0879:Stra6	UTSW	9	58135204	critical splice donor site	probably null
R1075:Stra6	UTSW	9	58151404	missense	possibly damaging	0.79
R1605:Stra6	UTSW	9	58151883	missense	probably benign
R1840:Stra6	UTSW	9	58140530	missense	probably benign	0.00
R1896:Stra6	UTSW	9	58151883	missense	probably benign
R2149:Stra6	UTSW	9	58152539	missense	probably benign	0.01
R4016:Stra6	UTSW	9	58135190	missense	probably damaging	0.99
R4127:Stra6	UTSW	9	58151218	missense	probably damaging	1.00
R4243:Stra6	UTSW	9	58143026	missense	probably benign	0.06
R4631:Stra6	UTSW	9	58140832	intron	probably benign
R4671:Stra6	UTSW	9	58149234	missense	probably benign	0.01
R4688:Stra6	UTSW	9	58135076	critical splice acceptor site	probably null
R5091:Stra6	UTSW	9	58141146	missense	probably damaging	1.00
R6179:Stra6	UTSW	9	58135169	missense	probably damaging	1.00
R6486:Stra6	UTSW	9	58151422	frame shift	probably null
R6593:Stra6	UTSW	9	58151979	missense	probably benign	0.00
R7368:Stra6	UTSW	9	58151260	missense	probably benign	0.03
R7395:Stra6	UTSW	9	58141097	missense	probably damaging	1.00
R7503:Stra6	UTSW	9	58151245	missense	possibly damaging	0.70
R8099:Stra6	UTSW	9	58152494	missense	probably damaging	1.00
R8377:Stra6	UTSW	9	58149205	missense	probably damaging	1.00
R8780:Stra6	UTSW	9	58134971	intron	probably benign
R8817:Stra6	UTSW	9	58151982	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTTAACCACCAGGCTCCTGAAG -3'
(R):5'- GGCTCCTAACCATCATCCAG -3'

Sequencing Primer
(F):5'- CCTGAGGTTCCCTGCTGATG -3'
(R):5'- TCCAGAGCAAGCTTCCTGAGAG -3'

Posted On

2019-11-26