Incidental Mutation 'R7807:Slc16a13'
ID600878
Institutional Source Beutler Lab
Gene Symbol Slc16a13
Ensembl Gene ENSMUSG00000044367
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 13
Synonyms1700007D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70216789-70221064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70220562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000053218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000326] [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000000326
SMART Domains Protein: ENSMUSP00000000326
Gene: ENSMUSG00000000317

DomainStartEndE-ValueType
BTB 38 135 2.17e-25 SMART
low complexity region 143 163 N/A INTRINSIC
ZnF_C2H2 323 345 4.11e-2 SMART
ZnF_C2H2 351 373 2.12e-4 SMART
ZnF_C2H2 379 401 8.34e-3 SMART
ZnF_C2H2 407 429 1.12e-3 SMART
ZnF_C2H2 435 458 1.33e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060010
AA Change: V39A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367
AA Change: V39A

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094055
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126388
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136328
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
AA Change: V39A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367
AA Change: V39A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159867
AA Change: V39A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367
AA Change: V39A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171032
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Slc16a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Slc16a13 APN 11 70220514 missense probably damaging 0.99
R0729:Slc16a13 UTSW 11 70219031 missense probably damaging 1.00
R0792:Slc16a13 UTSW 11 70220631 missense probably damaging 1.00
R1086:Slc16a13 UTSW 11 70219024 missense probably damaging 1.00
R1588:Slc16a13 UTSW 11 70218595 nonsense probably null
R1593:Slc16a13 UTSW 11 70219082 missense probably benign 0.04
R4329:Slc16a13 UTSW 11 70217897 missense probably benign 0.03
R4688:Slc16a13 UTSW 11 70220275 missense probably damaging 0.98
R6846:Slc16a13 UTSW 11 70217835 missense probably benign 0.35
R7380:Slc16a13 UTSW 11 70219279 missense probably damaging 1.00
R7390:Slc16a13 UTSW 11 70218971 missense probably benign 0.03
R7514:Slc16a13 UTSW 11 70218884 missense probably damaging 0.96
R7888:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCTAGGGAATTGGAATGGGTTC -3'
(R):5'- AGCGATTTAAAGCCCAGATCAG -3'

Sequencing Primer
(F):5'- TCTGCGAGGTGGTCTCC -3'
(R):5'- ATCAGGCAGGGGCTCTTAG -3'
Posted On2019-11-26