Incidental Mutation 'R7807:Hgs'
ID600882
Institutional Source Beutler Lab
Gene Symbol Hgs
Ensembl Gene ENSMUSG00000116045
Gene Name
SynonymsHrs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120467635-120483984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120479934 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 567 (A567S)
Ref Sequence ENSEMBL: ENSMUSP00000026900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000043627] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably damaging
Transcript: ENSMUST00000026900
AA Change: A567S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045
AA Change: A567S

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043627
SMART Domains Protein: ENSMUSP00000044417
Gene: ENSMUSG00000039640

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:Ribosomal_L12_N 64 120 4.5e-13 PFAM
Pfam:Ribosomal_L12 133 201 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106203
AA Change: A567S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793
AA Change: A567S

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106205
AA Change: A566S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793
AA Change: A566S

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115037
Gene: ENSMUSG00000025793
AA Change: A238S

DomainStartEndE-ValueType
Pfam:Hrs_helical 112 172 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140862
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis with decreased size and no embryo turning. In addition, one allele shows cardia bifida, no foregut formation, failure of chorioallantoic fusion and neural tube,somite and allantois defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Hgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Hgs APN 11 120475214 missense probably damaging 1.00
IGL01520:Hgs APN 11 120478348 missense probably damaging 1.00
IGL01532:Hgs APN 11 120477509 splice site probably null
IGL02346:Hgs APN 11 120482551 missense probably damaging 0.99
IGL02808:Hgs APN 11 120469666 nonsense probably null
LCD18:Hgs UTSW 11 120469578 splice site probably benign
R0100:Hgs UTSW 11 120482852 missense possibly damaging 0.83
R0462:Hgs UTSW 11 120479144 missense possibly damaging 0.96
R0653:Hgs UTSW 11 120469078 missense probably damaging 1.00
R0719:Hgs UTSW 11 120471605 critical splice donor site probably null
R1482:Hgs UTSW 11 120480040 missense probably benign 0.09
R1757:Hgs UTSW 11 120480063 missense probably damaging 0.98
R1782:Hgs UTSW 11 120478505 missense probably damaging 1.00
R2311:Hgs UTSW 11 120479648 missense probably damaging 1.00
R4077:Hgs UTSW 11 120477376 missense probably damaging 1.00
R4078:Hgs UTSW 11 120483048 missense probably benign 0.04
R4079:Hgs UTSW 11 120483048 missense probably benign 0.04
R4094:Hgs UTSW 11 120469033 nonsense probably null
R4204:Hgs UTSW 11 120477187 missense probably damaging 1.00
R4911:Hgs UTSW 11 120477202 missense probably damaging 0.98
R6477:Hgs UTSW 11 120469655 missense probably damaging 1.00
R6816:Hgs UTSW 11 120471571 missense probably damaging 1.00
R7264:Hgs UTSW 11 120474313 missense probably benign 0.00
R7633:Hgs UTSW 11 120474302 missense probably damaging 0.98
R8683:Hgs UTSW 11 120475218 nonsense probably null
R8733:Hgs UTSW 11 120470128 critical splice donor site probably null
R8798:Hgs UTSW 11 120480112 missense probably benign 0.08
R8866:Hgs UTSW 11 120469638 missense probably benign 0.10
R8910:Hgs UTSW 11 120478376 critical splice donor site probably null
X0024:Hgs UTSW 11 120477314 missense probably damaging 1.00
Z1177:Hgs UTSW 11 120478565 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCACAGAAACTGGAGATC -3'
(R):5'- ATACACACCATGCATCGGAGAG -3'

Sequencing Primer
(F):5'- AGGTATGGCAGCTGACCCAG -3'
(R):5'- ATCGGAGAGCCCTCTACTGAG -3'
Posted On2019-11-26