Incidental Mutation 'R7807:Hectd1'
ID 600883
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene Name HECT domain E3 ubiquitin protein ligase 1
Synonyms A630086P08Rik, b2b327Clo, opm
MMRRC Submission 045862-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 51790505-51876319 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51792171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 2523 (R2523C)
Ref Sequence ENSEMBL: ENSMUSP00000136449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]
AlphaFold Q69ZR2
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: R2515C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: R2515C

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179265
AA Change: R2523C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: R2523C

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 C A 9: 21,447,276 (GRCm39) T146K probably benign Het
Alms1 T A 6: 85,599,958 (GRCm39) S1595T possibly damaging Het
Ankrd44 A T 1: 54,831,635 (GRCm39) I56N probably damaging Het
Anln C A 9: 22,272,176 (GRCm39) V648F probably damaging Het
Arhgap29 A G 3: 121,807,981 (GRCm39) D1053G probably benign Het
Baalc T C 15: 38,797,412 (GRCm39) S68P probably benign Het
Begain T C 12: 109,004,856 (GRCm39) D52G probably damaging Het
Blmh A G 11: 76,837,040 (GRCm39) I41V probably benign Het
Bpifc T A 10: 85,812,114 (GRCm39) I365F possibly damaging Het
C2 G T 17: 35,095,347 (GRCm39) S199R possibly damaging Het
Ccbe1 T A 18: 66,199,828 (GRCm39) H298L probably damaging Het
Ccdc112 T A 18: 46,423,826 (GRCm39) K304I probably damaging Het
Ccdc15 T C 9: 37,226,678 (GRCm39) E432G probably benign Het
Cdh13 T A 8: 119,010,594 (GRCm39) M1K probably null Het
Cipc T C 12: 87,008,899 (GRCm39) S253P possibly damaging Het
Clcn1 A G 6: 42,287,282 (GRCm39) probably null Het
Clock A T 5: 76,390,982 (GRCm39) N273K probably benign Het
Cyp19a1 T C 9: 54,074,126 (GRCm39) D476G probably benign Het
Dnaaf9 T C 2: 130,552,785 (GRCm39) K1092E probably damaging Het
Dnah7b A G 1: 46,253,527 (GRCm39) I1811V probably benign Het
Fat1 C A 8: 45,495,010 (GRCm39) T4091K probably damaging Het
Gm10340 T A 14: 14,826,724 (GRCm39) N64K probably damaging Het
Hgf A G 5: 16,782,009 (GRCm39) H244R probably damaging Het
Hgs G T 11: 120,370,760 (GRCm39) A567S probably damaging Het
Igdcc4 T C 9: 65,041,077 (GRCm39) V1036A probably benign Het
Keg1 G A 19: 12,691,998 (GRCm39) probably null Het
Klhl8 A T 5: 104,023,932 (GRCm39) L156Q probably damaging Het
Lmln T C 16: 32,927,501 (GRCm39) Y521H probably benign Het
Lrrc7 A G 3: 157,866,124 (GRCm39) S1206P probably damaging Het
Mad1l1 T A 5: 140,074,541 (GRCm39) I550F probably benign Het
Marf1 C T 16: 13,971,753 (GRCm39) W28* probably null Het
Mfsd11 T G 11: 116,754,733 (GRCm39) S215A probably benign Het
Mpped2 C A 2: 106,575,085 (GRCm39) H57N possibly damaging Het
Mslnl A G 17: 25,965,751 (GRCm39) M542V probably benign Het
Myh6 G T 14: 55,179,897 (GRCm39) H1903Q probably damaging Het
Neo1 T C 9: 58,897,777 (GRCm39) T60A probably benign Het
Npm2 T A 14: 70,889,947 (GRCm39) probably null Het
Or5b123 C A 19: 13,597,285 (GRCm39) T210K probably damaging Het
Or5d20-ps1 T C 2: 87,931,909 (GRCm39) S141G probably benign Het
Or7a39 T A 10: 78,715,043 (GRCm39) S12R probably benign Het
Pax9 A T 12: 56,743,850 (GRCm39) I166F possibly damaging Het
Pcsk9 A G 4: 106,321,092 (GRCm39) S6P possibly damaging Het
Pikfyve A G 1: 65,309,101 (GRCm39) Y1893C probably damaging Het
Pirb T C 7: 3,722,864 (GRCm39) T43A possibly damaging Het
Pou3f1 A G 4: 124,552,074 (GRCm39) D192G possibly damaging Het
Pus3 C G 9: 35,478,021 (GRCm39) R418G probably damaging Het
Rexo1 C T 10: 80,385,970 (GRCm39) V363I probably benign Het
Sdcbp A G 4: 6,393,688 (GRCm39) T269A probably damaging Het
Sele T C 1: 163,881,462 (GRCm39) V523A probably benign Het
Serpinb8 T A 1: 107,532,457 (GRCm39) M183K probably damaging Het
Sh2d4a T G 8: 68,735,033 (GRCm39) S51A probably benign Het
Siglec15 A G 18: 78,090,696 (GRCm39) S201P probably damaging Het
Slc10a5 C T 3: 10,400,529 (GRCm39) V44I probably benign Het
Slc16a13 A G 11: 70,111,388 (GRCm39) V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 (GRCm39) R184W probably damaging Het
Slc35f5 T A 1: 125,512,278 (GRCm39) D359E probably damaging Het
Slc3a1 A G 17: 85,371,371 (GRCm39) E641G probably benign Het
Slf1 T C 13: 77,194,823 (GRCm39) D834G probably damaging Het
Spata31f1e A C 4: 42,793,885 (GRCm39) H82Q probably benign Het
Stim1 T C 7: 102,076,348 (GRCm39) I433T probably damaging Het
Stra6 T A 9: 58,057,444 (GRCm39) I418K probably damaging Het
Tanc2 A G 11: 105,758,480 (GRCm39) N747S probably benign Het
Tet2 T C 3: 133,192,302 (GRCm39) T711A possibly damaging Het
Trpm6 T C 19: 18,807,220 (GRCm39) I988T probably benign Het
Ttc41 T A 10: 86,612,495 (GRCm39) I1256N probably benign Het
Uba2 T C 7: 33,862,638 (GRCm39) D100G possibly damaging Het
Vmn1r43 A G 6: 89,847,219 (GRCm39) I89T probably benign Het
Vmn2r58 T A 7: 41,521,910 (GRCm39) Y62F probably benign Het
Ylpm1 C T 12: 85,060,855 (GRCm39) Q428* probably null Het
Zcrb1 T C 15: 93,289,002 (GRCm39) D88G probably damaging Het
Zmym1 A C 4: 126,941,667 (GRCm39) I907S probably damaging Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51,806,215 (GRCm39) missense probably benign
IGL00402:Hectd1 APN 12 51,815,891 (GRCm39) missense possibly damaging 0.94
IGL00419:Hectd1 APN 12 51,810,818 (GRCm39) missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51,823,272 (GRCm39) splice site probably benign
IGL00565:Hectd1 APN 12 51,837,181 (GRCm39) missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51,820,787 (GRCm39) missense probably benign 0.17
IGL00576:Hectd1 APN 12 51,806,092 (GRCm39) missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51,795,571 (GRCm39) missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51,838,173 (GRCm39) missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51,807,904 (GRCm39) missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51,849,057 (GRCm39) missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51,850,562 (GRCm39) missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51,849,593 (GRCm39) missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51,829,337 (GRCm39) missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51,841,280 (GRCm39) nonsense probably null
IGL01994:Hectd1 APN 12 51,844,725 (GRCm39) missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51,820,920 (GRCm39) missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51,815,974 (GRCm39) missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51,800,916 (GRCm39) splice site probably benign
IGL02177:Hectd1 APN 12 51,819,103 (GRCm39) missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51,844,635 (GRCm39) missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51,847,496 (GRCm39) critical splice donor site probably null
IGL02519:Hectd1 APN 12 51,815,894 (GRCm39) missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51,809,233 (GRCm39) missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51,810,864 (GRCm39) missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51,814,423 (GRCm39) missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51,837,396 (GRCm39) missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51,815,670 (GRCm39) missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51,791,550 (GRCm39) missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51,874,205 (GRCm39) missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51,815,957 (GRCm39) missense probably benign 0.00
IGL03078:Hectd1 APN 12 51,849,019 (GRCm39) missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51,847,671 (GRCm39) splice site probably benign
3-1:Hectd1 UTSW 12 51,800,590 (GRCm39) missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51,800,608 (GRCm39) missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51,816,101 (GRCm39) missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51,815,891 (GRCm39) missense possibly damaging 0.94
R0268:Hectd1 UTSW 12 51,815,890 (GRCm39) missense probably damaging 0.99
R0409:Hectd1 UTSW 12 51,829,339 (GRCm39) missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51,795,440 (GRCm39) missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51,807,855 (GRCm39) missense probably benign 0.11
R1087:Hectd1 UTSW 12 51,823,355 (GRCm39) missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51,810,947 (GRCm39) splice site probably benign
R1350:Hectd1 UTSW 12 51,809,217 (GRCm39) missense probably benign
R1553:Hectd1 UTSW 12 51,820,661 (GRCm39) missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51,800,607 (GRCm39) missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51,791,571 (GRCm39) missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51,791,375 (GRCm39) missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51,800,590 (GRCm39) missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51,791,577 (GRCm39) missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51,853,350 (GRCm39) missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51,847,738 (GRCm39) missense probably benign 0.00
R1982:Hectd1 UTSW 12 51,832,624 (GRCm39) missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51,803,899 (GRCm39) splice site probably null
R2061:Hectd1 UTSW 12 51,841,227 (GRCm39) missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51,795,325 (GRCm39) missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51,792,277 (GRCm39) missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51,853,245 (GRCm39) missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51,853,254 (GRCm39) missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51,815,791 (GRCm39) missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51,792,317 (GRCm39) missense probably benign 0.01
R3876:Hectd1 UTSW 12 51,815,513 (GRCm39) missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51,849,219 (GRCm39) critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51,821,533 (GRCm39) missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51,815,506 (GRCm39) nonsense probably null
R4116:Hectd1 UTSW 12 51,815,506 (GRCm39) nonsense probably null
R4169:Hectd1 UTSW 12 51,837,008 (GRCm39) missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51,798,835 (GRCm39) missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51,837,276 (GRCm39) missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51,798,715 (GRCm39) missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51,791,356 (GRCm39) missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51,834,695 (GRCm39) missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51,874,134 (GRCm39) critical splice donor site probably null
R4883:Hectd1 UTSW 12 51,831,030 (GRCm39) nonsense probably null
R4885:Hectd1 UTSW 12 51,847,505 (GRCm39) missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51,809,280 (GRCm39) missense probably benign 0.02
R4983:Hectd1 UTSW 12 51,831,045 (GRCm39) missense probably benign 0.01
R5007:Hectd1 UTSW 12 51,849,443 (GRCm39) missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51,797,171 (GRCm39) missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51,791,662 (GRCm39) missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51,874,272 (GRCm39) start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51,849,316 (GRCm39) critical splice donor site probably null
R5535:Hectd1 UTSW 12 51,849,109 (GRCm39) missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51,810,897 (GRCm39) missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51,820,618 (GRCm39) missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51,845,537 (GRCm39) missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51,849,035 (GRCm39) missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51,815,855 (GRCm39) missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51,800,887 (GRCm39) missense probably benign
R6141:Hectd1 UTSW 12 51,792,875 (GRCm39) critical splice donor site probably null
R6172:Hectd1 UTSW 12 51,816,065 (GRCm39) missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51,795,228 (GRCm39) missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51,791,402 (GRCm39) missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51,841,270 (GRCm39) missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51,810,945 (GRCm39) splice site probably null
R6971:Hectd1 UTSW 12 51,795,526 (GRCm39) nonsense probably null
R7079:Hectd1 UTSW 12 51,834,638 (GRCm39) missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51,874,134 (GRCm39) critical splice donor site probably null
R7171:Hectd1 UTSW 12 51,806,080 (GRCm39) missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51,832,635 (GRCm39) missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51,797,104 (GRCm39) missense probably benign
R7355:Hectd1 UTSW 12 51,838,081 (GRCm39) missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51,791,588 (GRCm39) splice site probably null
R7531:Hectd1 UTSW 12 51,853,150 (GRCm39) missense probably benign 0.33
R7532:Hectd1 UTSW 12 51,837,233 (GRCm39) missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51,849,003 (GRCm39) missense possibly damaging 0.86
R7842:Hectd1 UTSW 12 51,819,343 (GRCm39) missense probably damaging 0.99
R7922:Hectd1 UTSW 12 51,836,978 (GRCm39) nonsense probably null
R8059:Hectd1 UTSW 12 51,837,161 (GRCm39) missense possibly damaging 0.53
R8085:Hectd1 UTSW 12 51,795,679 (GRCm39) missense probably damaging 0.97
R8145:Hectd1 UTSW 12 51,831,016 (GRCm39) missense possibly damaging 0.72
R8157:Hectd1 UTSW 12 51,838,073 (GRCm39) missense possibly damaging 0.53
R8405:Hectd1 UTSW 12 51,874,178 (GRCm39) missense probably benign 0.01
R8505:Hectd1 UTSW 12 51,797,145 (GRCm39) missense probably damaging 1.00
R8511:Hectd1 UTSW 12 51,834,654 (GRCm39) missense probably benign 0.01
R8697:Hectd1 UTSW 12 51,819,320 (GRCm39) critical splice donor site probably benign
R8725:Hectd1 UTSW 12 51,849,000 (GRCm39) missense possibly damaging 0.92
R8727:Hectd1 UTSW 12 51,849,000 (GRCm39) missense possibly damaging 0.92
R8911:Hectd1 UTSW 12 51,795,616 (GRCm39) missense probably damaging 0.99
R8983:Hectd1 UTSW 12 51,791,410 (GRCm39) missense probably damaging 0.97
R9037:Hectd1 UTSW 12 51,832,665 (GRCm39) missense possibly damaging 0.85
R9219:Hectd1 UTSW 12 51,800,612 (GRCm39) missense probably damaging 0.99
R9413:Hectd1 UTSW 12 51,792,880 (GRCm39) nonsense probably null
R9456:Hectd1 UTSW 12 51,832,584 (GRCm39) missense probably benign
R9513:Hectd1 UTSW 12 51,816,079 (GRCm39) missense possibly damaging 0.92
R9640:Hectd1 UTSW 12 51,795,197 (GRCm39) nonsense probably null
R9641:Hectd1 UTSW 12 51,816,047 (GRCm39) missense probably benign 0.00
R9713:Hectd1 UTSW 12 51,823,328 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAAAGCCGTCTGAGCAC -3'
(R):5'- GAACTGAGTCTGTGCTTTGC -3'

Sequencing Primer
(F):5'- TACCCAGGGTAAATGTGG -3'
(R):5'- AACTGAGTCTGTGCTTTGCTCTTTTC -3'
Posted On 2019-11-26