Incidental Mutation 'R7807:Pax9'
ID 600884
Institutional Source Beutler Lab
Gene Symbol Pax9
Ensembl Gene ENSMUSG00000001497
Gene Name paired box 9
Synonyms Pax-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 56691767-56712822 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56697065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 166 (I166F)
Ref Sequence ENSEMBL: ENSMUSP00000001538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001538] [ENSMUST00000153250]
AlphaFold P47242
Predicted Effect possibly damaging
Transcript: ENSMUST00000001538
AA Change: I166F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001538
Gene: ENSMUSG00000001497
AA Change: I166F

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153250
AA Change: I166F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117928
Gene: ENSMUSG00000001497
AA Change: I166F

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal tooth development and absent teeth and may lead to lack of pharyngeal pouch derivatives, athymia, craniofacial and limb anomalies, a small tympanic ring, various defects of the skeleton and musculature, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Pax9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pax9 APN 12 56700075 missense probably benign
IGL02724:Pax9 APN 12 56709819 missense possibly damaging 0.76
R0008:Pax9 UTSW 12 56709743 missense probably benign
R0008:Pax9 UTSW 12 56709743 missense probably benign
R1836:Pax9 UTSW 12 56700054 missense probably benign 0.03
R1916:Pax9 UTSW 12 56697138 missense possibly damaging 0.60
R2907:Pax9 UTSW 12 56709744 missense probably benign 0.03
R3778:Pax9 UTSW 12 56696748 missense probably damaging 1.00
R4905:Pax9 UTSW 12 56696626 missense probably damaging 1.00
R6247:Pax9 UTSW 12 56709695 missense probably benign
R6469:Pax9 UTSW 12 56696863 missense probably damaging 1.00
R6693:Pax9 UTSW 12 56709731 missense probably benign 0.08
R7343:Pax9 UTSW 12 56695862 start codon destroyed probably null 0.48
R7739:Pax9 UTSW 12 56700099 missense probably benign 0.00
R8458:Pax9 UTSW 12 56696765 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GTGTGCGACAAGTACAACG -3'
(R):5'- AGGTGGTGGGATAGACACTC -3'

Sequencing Primer
(F):5'- AAGTACAACGTGCCCTCGG -3'
(R):5'- TGGTGGGATAGACACTCGCTAG -3'
Posted On 2019-11-26