Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Pax9'

600884

Institutional Source

Beutler Lab

Gene Symbol

Pax9

Ensembl Gene

ENSMUSG00000001497

Gene Name

paired box 9

Synonyms

Pax-9

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R7807 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56691767-56712822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56697065 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 166 (I166F)

Ref Sequence

ENSEMBL: ENSMUSP00000001538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001538] [ENSMUST00000153250]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001538
AA Change: I166F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000001538
Gene: ENSMUSG00000001497
AA Change: I166F

Domain	Start	End	E-Value	Type
PAX	4	128	6.81e-90	SMART
low complexity region	265	274	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153250
AA Change: I166F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117928
Gene: ENSMUSG00000001497
AA Change: I166F

Domain	Start	End	E-Value	Type
PAX	4	128	6.81e-90	SMART
low complexity region	265	274	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal tooth development and absent teeth and may lead to lack of pharyngeal pouch derivatives, athymia, craniofacial and limb anomalies, a small tympanic ring, various defects of the skeleton and musculature, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Pax9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Pax9	APN	12	56700075	missense	probably benign
IGL02724:Pax9	APN	12	56709819	missense	possibly damaging	0.76
R0008:Pax9	UTSW	12	56709743	missense	probably benign
R0008:Pax9	UTSW	12	56709743	missense	probably benign
R1836:Pax9	UTSW	12	56700054	missense	probably benign	0.03
R1916:Pax9	UTSW	12	56697138	missense	possibly damaging	0.60
R2907:Pax9	UTSW	12	56709744	missense	probably benign	0.03
R3778:Pax9	UTSW	12	56696748	missense	probably damaging	1.00
R4905:Pax9	UTSW	12	56696626	missense	probably damaging	1.00
R6247:Pax9	UTSW	12	56709695	missense	probably benign
R6469:Pax9	UTSW	12	56696863	missense	probably damaging	1.00
R6693:Pax9	UTSW	12	56709731	missense	probably benign	0.08
R7343:Pax9	UTSW	12	56695862	start codon destroyed	probably null	0.48
R7739:Pax9	UTSW	12	56700099	missense	probably benign	0.00
R8458:Pax9	UTSW	12	56696765	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GTGTGCGACAAGTACAACG -3'
(R):5'- AGGTGGTGGGATAGACACTC -3'

Sequencing Primer
(F):5'- AAGTACAACGTGCCCTCGG -3'
(R):5'- TGGTGGGATAGACACTCGCTAG -3'

Posted On

2019-11-26