Incidental Mutation 'R7807:Cipc'
ID 600886
Institutional Source Beutler Lab
Gene Symbol Cipc
Ensembl Gene ENSMUSG00000034157
Gene Name CLOCK interacting protein, circadian
Synonyms 2310044G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 86947043-86965362 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86962125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000141049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038369] [ENSMUST00000185434] [ENSMUST00000187814] [ENSMUST00000188046] [ENSMUST00000189246] [ENSMUST00000190588] [ENSMUST00000191032] [ENSMUST00000191463]
AlphaFold Q8R0W1
Predicted Effect possibly damaging
Transcript: ENSMUST00000038369
AA Change: S232P

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038630
Gene: ENSMUSG00000034157
AA Change: S232P

DomainStartEndE-ValueType
Pfam:CiPC 52 388 6.6e-107 PFAM
low complexity region 390 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185434
Predicted Effect probably benign
Transcript: ENSMUST00000185783
Predicted Effect probably benign
Transcript: ENSMUST00000186499
Predicted Effect possibly damaging
Transcript: ENSMUST00000187814
AA Change: S253P

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141049
Gene: ENSMUSG00000034157
AA Change: S253P

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
coiled coil region 364 396 N/A INTRINSIC
low complexity region 411 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188046
Predicted Effect possibly damaging
Transcript: ENSMUST00000189246
AA Change: S232P

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140266
Gene: ENSMUSG00000034157
AA Change: S232P

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
coiled coil region 343 375 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190588
Predicted Effect probably benign
Transcript: ENSMUST00000191032
Predicted Effect possibly damaging
Transcript: ENSMUST00000191463
AA Change: S250P

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140683
Gene: ENSMUSG00000034157
AA Change: S250P

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 308 323 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal circadian rhythms and behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Cipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01860:Cipc APN 12 86960273 missense probably damaging 1.00
IGL01953:Cipc APN 12 86952764 missense possibly damaging 0.91
IGL02218:Cipc APN 12 86961928 missense probably damaging 1.00
R4596:Cipc UTSW 12 86961954 missense probably benign 0.01
R4651:Cipc UTSW 12 86962090 missense probably benign 0.00
R4652:Cipc UTSW 12 86962090 missense probably benign 0.00
R4696:Cipc UTSW 12 86952940 splice site probably benign
R4911:Cipc UTSW 12 86952757 missense probably benign 0.02
R5634:Cipc UTSW 12 86952975 splice site probably null
R6667:Cipc UTSW 12 86962090 missense probably benign 0.00
R8308:Cipc UTSW 12 86962035 missense probably benign 0.00
R9026:Cipc UTSW 12 86952860 missense probably damaging 0.98
R9262:Cipc UTSW 12 86952723 nonsense probably null
Z1176:Cipc UTSW 12 86960337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAACTACTTGCCCATTC -3'
(R):5'- AGGTGAAGTGTAACTGGCTG -3'

Sequencing Primer
(F):5'- AGAAACTACTTGCCCATTCTAAATTC -3'
(R):5'- GAGCTGCTCTCTAGGCCATG -3'
Posted On 2019-11-26