Incidental Mutation 'R7807:Marf1'
ID 600893
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Name meiosis regulator and mRNA stability 1
Synonyms 4921513D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 14109173-14163351 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 14153889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 28 (W28*)
Ref Sequence ENSEMBL: ENSMUSP00000087770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000090300
AA Change: W28*
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: W28*

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229614
AA Change: W28*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 14128568 missense probably benign 0.22
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0589:Marf1 UTSW 16 14142055 splice site probably benign
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5905:Marf1 UTSW 16 14127249 missense probably damaging 0.99
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6533:Marf1 UTSW 16 14115799 missense probably benign 0.16
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
R7557:Marf1 UTSW 16 14132696 missense probably damaging 1.00
R7798:Marf1 UTSW 16 14138451 missense probably benign 0.00
R7855:Marf1 UTSW 16 14114201 missense probably benign 0.27
R7867:Marf1 UTSW 16 14128606 missense probably damaging 0.97
R7893:Marf1 UTSW 16 14146735 missense probably damaging 1.00
R8291:Marf1 UTSW 16 14132568 critical splice donor site probably null
R8746:Marf1 UTSW 16 14117304 missense probably benign 0.18
R8842:Marf1 UTSW 16 14117305 missense probably damaging 1.00
R9253:Marf1 UTSW 16 14117308 missense probably damaging 1.00
R9350:Marf1 UTSW 16 14145925 missense probably damaging 1.00
R9440:Marf1 UTSW 16 14120332 missense probably benign 0.01
R9460:Marf1 UTSW 16 14129662 missense probably damaging 1.00
R9658:Marf1 UTSW 16 14140223 missense probably damaging 1.00
R9698:Marf1 UTSW 16 14149213 missense probably benign 0.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Z1176:Marf1 UTSW 16 14115777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTTGAGCAAGCGTGTTC -3'
(R):5'- GAGCTGTTGCACCATGAAC -3'

Sequencing Primer
(F):5'- AGCAAGCGTGTTCTTATTGAGTGC -3'
(R):5'- TGGGTACTTGTGCAAAGAAGTAAC -3'
Posted On 2019-11-26