Incidental Mutation 'R7807:Slc3a1'
ID 600897
Institutional Source Beutler Lab
Gene Symbol Slc3a1
Ensembl Gene ENSMUSG00000024131
Gene Name solute carrier family 3, member 1
Synonyms NTAA, D2H
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7807 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 85028347-85064243 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85063943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 641 (E641G)
Ref Sequence ENSEMBL: ENSMUSP00000024944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024944] [ENSMUST00000072406] [ENSMUST00000171795]
AlphaFold Q91WV7
Predicted Effect probably benign
Transcript: ENSMUST00000024944
AA Change: E641G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024944
Gene: ENSMUSG00000024131
AA Change: E641G

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
Aamy 124 504 6.7e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072406
SMART Domains Protein: ENSMUSP00000072239
Gene: ENSMUSG00000024127

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 15 339 7.4e-28 PFAM
Pfam:Peptidase_S9 399 623 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171795
SMART Domains Protein: ENSMUSP00000130967
Gene: ENSMUSG00000024127

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 86 428 5.2e-30 PFAM
Pfam:Peptidase_S9 486 710 2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus results in renal absorption defects and cystine urolithiasis. Homozygous mutant mice serve as a mouse model for human cystinuria type I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Slc3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc3a1 APN 17 85060833 missense probably damaging 1.00
IGL00647:Slc3a1 APN 17 85063805 missense probably damaging 0.99
IGL02755:Slc3a1 APN 17 85037177 missense probably damaging 1.00
IGL03079:Slc3a1 APN 17 85059823 nonsense probably null
IGL03390:Slc3a1 APN 17 85032777 missense probably damaging 1.00
R0031:Slc3a1 UTSW 17 85032846 missense probably damaging 1.00
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0363:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R0531:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R0636:Slc3a1 UTSW 17 85032794 missense possibly damaging 0.78
R0662:Slc3a1 UTSW 17 85037207 missense possibly damaging 0.89
R0725:Slc3a1 UTSW 17 85060835 nonsense probably null
R0930:Slc3a1 UTSW 17 85059743 missense probably benign 0.01
R1141:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R2025:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R2271:Slc3a1 UTSW 17 85063792 missense probably benign 0.00
R4196:Slc3a1 UTSW 17 85060878 missense probably damaging 1.00
R4740:Slc3a1 UTSW 17 85046753 missense probably benign 0.00
R5049:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R5255:Slc3a1 UTSW 17 85028453 splice site probably null
R5261:Slc3a1 UTSW 17 85051975 missense probably damaging 1.00
R5601:Slc3a1 UTSW 17 85032891 missense probably benign 0.00
R5853:Slc3a1 UTSW 17 85032580 missense probably damaging 1.00
R6063:Slc3a1 UTSW 17 85028523 missense probably benign
R6332:Slc3a1 UTSW 17 85028432 start codon destroyed probably damaging 0.99
R7162:Slc3a1 UTSW 17 85064014 nonsense probably null
R7269:Slc3a1 UTSW 17 85032445 missense probably damaging 1.00
R7516:Slc3a1 UTSW 17 85063762 missense probably damaging 1.00
R8269:Slc3a1 UTSW 17 85032554 missense probably benign 0.00
R8351:Slc3a1 UTSW 17 85028496 missense possibly damaging 0.68
R8361:Slc3a1 UTSW 17 85037212 nonsense probably null
R8451:Slc3a1 UTSW 17 85028496 missense possibly damaging 0.68
R8543:Slc3a1 UTSW 17 85028497 missense probably benign 0.42
R9764:Slc3a1 UTSW 17 85063991 missense probably damaging 1.00
X0020:Slc3a1 UTSW 17 85028808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACGGCATAGATAACGTC -3'
(R):5'- AACAGTGCATTCGTGCTACAG -3'

Sequencing Primer
(F):5'- GGACGGCATAGATAACGTCTTCCTC -3'
(R):5'- GAATTGATGCCATTCATGAGTCTGC -3'
Posted On 2019-11-26