Incidental Mutation 'R7807:Trpm6'
ID600903
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7807 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18829856 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 988 (I988T)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: I988T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: I988T

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cdh13 T A 8: 118,283,855 M1K probably null Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
R8534:Trpm6 UTSW 19 18892095 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAGGGAATCCTGGGAAC -3'
(R):5'- GATTCTGAGTGAAGGCAAAACC -3'

Sequencing Primer
(F):5'- GGAATCCTGGGAACATGTAGTAG -3'
(R):5'- GGCAAAACCTCATATGTACCATC -3'
Posted On2019-11-26