Mutagenetix > Incidental Mutation

Incidental Mutation 'R7808:Nav1'

600906

Institutional Source

Beutler Lab

Gene Symbol

Nav1

Ensembl Gene

ENSMUSG00000009418

Gene Name

neuron navigator 1

Synonyms

steerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R7808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135434580-135607295 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135452248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1512 (Y1512C)

Ref Sequence

ENSEMBL: ENSMUSP00000140322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]

AlphaFold

Q8CH77

Predicted Effect

probably damaging
Transcript: ENSMUST00000040599
AA Change: Y1572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: Y1572C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067414
AA Change: Y1572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: Y1572C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189252

Predicted Effect

unknown
Transcript: ENSMUST00000190298
AA Change: Y1512C

SMART Domains

Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: Y1512C

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1013	1048	N/A	INTRINSIC
low complexity region	1122	1153	N/A	INTRINSIC
low complexity region	1200	1221	N/A	INTRINSIC
low complexity region	1236	1244	N/A	INTRINSIC
coiled coil region	1268	1300	N/A	INTRINSIC
AAA	1488	1642	3.16e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	T	C	2: 91,444,594		probably benign	Het
1700113H08Rik	T	C	10: 87,121,435	V11A	probably benign	Het
Abca12	A	T	1: 71,274,634		probably null	Het
Abcc12	T	A	8: 86,507,939	M1232L	probably benign	Het
Adamts1	T	C	16: 85,800,229	Y314C	probably damaging	Het
Adgb	A	G	10: 10,378,659		probably null	Het
Ankrd12	T	A	17: 65,985,653	K928N	possibly damaging	Het
Ano5	A	T	7: 51,587,795	K789I	possibly damaging	Het
Cacna1d	G	T	14: 30,111,069	N938K	probably damaging	Het
Camk1g	T	C	1: 193,350,285	R273G	possibly damaging	Het
Caprin2	C	A	6: 148,843,030	V966F	probably damaging	Het
Card6	T	C	15: 5,099,472	H814R	probably benign	Het
Ccdc84	T	C	9: 44,412,918	Q228R	probably null	Het
Cflar	A	G	1: 58,711,581		probably benign	Het
Cftr	T	A	6: 18,204,205	N66K	probably benign	Het
Clasrp	C	T	7: 19,588,746		probably null	Het
Clec4a4	T	C	6: 122,990,380	I5T	probably damaging	Het
Cmtr2	T	C	8: 110,221,619	I187T	possibly damaging	Het
Cnga1	A	T	5: 72,604,273	F633I	possibly damaging	Het
Col16a1	C	T	4: 130,073,264	P909S	unknown	Het
Csf1	C	A	3: 107,760,045	A7S	possibly damaging	Het
Dhx30	A	T	9: 110,086,202	V833D	probably benign	Het
Dlg2	T	G	7: 92,431,055	I712M	probably benign	Het
Dmxl1	T	A	18: 49,878,315	F1180I	probably benign	Het
Dnah9	T	A	11: 66,005,805	K2398*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Dync1h1	A	T	12: 110,655,459	N3412I	possibly damaging	Het
Dync1i2	T	A	2: 71,250,834		probably null	Het
Dysf	T	C	6: 84,070,929	S333P	possibly damaging	Het
Eed	A	T	7: 89,956,333	N349K	probably benign	Het
Eipr1	A	T	12: 28,766,770		probably null	Het
Fam160a2	G	A	7: 105,384,525	R509C	probably damaging	Het
Fbxw16	A	C	9: 109,448,154	V40G	probably damaging	Het
Fgfr4	A	C	13: 55,161,156	R363S	possibly damaging	Het
Fgl2	A	T	5: 21,373,231	N172I	possibly damaging	Het
Gabbr2	T	A	4: 46,875,744	H126L	possibly damaging	Het
Gcnt2	A	T	13: 40,860,862	N170Y	possibly damaging	Het
Gpt	A	G	15: 76,698,893		probably null	Het
Igsf10	A	G	3: 59,328,068	I1564T	probably benign	Het
Il22ra1	C	A	4: 135,750,796	Q393K	possibly damaging	Het
Inpp5d	A	T	1: 87,683,845	K340*	probably null	Het
Jcad	A	G	18: 4,673,113	K292E	probably damaging	Het
Krt5	T	A	15: 101,709,018	T427S	probably benign	Het
Krt76	T	C	15: 101,890,494	D252G	probably damaging	Het
Krtap26-1	A	G	16: 88,647,310	V141A	not run	Het
Lce6a	A	T	3: 92,620,335	V55D	probably benign	Het
Lpxn	C	T	19: 12,824,821	S170F	possibly damaging	Het
Magi2	T	C	5: 20,465,840	V394A	probably benign	Het
Mbnl1	G	A	3: 60,614,821		probably null	Het
Med16	T	A	10: 79,898,418	K554M	probably damaging	Het
Mettl14	T	C	3: 123,372,585	D276G	possibly damaging	Het
Mphosph9	T	C	5: 124,260,946	D1002G	probably damaging	Het
Mroh9	T	C	1: 163,039,109	E686G	probably damaging	Het
Neb	T	C	2: 52,192,023	Y5712C	probably damaging	Het
Nek7	T	A	1: 138,561,771		probably benign	Het
Nptx1	T	A	11: 119,544,636	I285F	probably damaging	Het
Oas1d	G	T	5: 120,914,971	E30*	probably null	Het
Olfr404-ps1	A	T	11: 74,239,899	I112F	probably damaging	Het
Olfr429	C	A	1: 174,089,851	Y270*	probably null	Het
Olfr577	A	G	7: 102,973,110	V294A	possibly damaging	Het
Parp4	T	G	14: 56,635,748	S1150A	possibly damaging	Het
Pinx1	A	T	14: 63,919,292	K223*	probably null	Het
Plekha5	T	C	6: 140,583,914	L1034S	probably damaging	Het
Ppp4r3a	A	G	12: 101,053,496	V400A	possibly damaging	Het
Prtg	A	T	9: 72,842,697	I128F	possibly damaging	Het
Rars	T	C	11: 35,828,707	E96G	probably benign	Het
Rhpn1	T	A	15: 75,713,450	S551T	probably benign	Het
Selenow	C	T	7: 15,922,251		probably null	Het
Serpina9	A	T	12: 104,001,225		probably null	Het
Shank3	A	T	15: 89,548,880	D1276V	probably damaging	Het
Slc17a2	A	C	13: 23,819,334	H285P	probably damaging	Het
Slc27a6	A	G	18: 58,609,195	T494A	probably damaging	Het
Slc6a21	A	C	7: 45,282,936	T54P		Het
Syne2	A	G	12: 75,983,727		probably null	Het
Tal1	T	C	4: 115,068,292	V186A	probably benign	Het
Tarsl2	A	G	7: 65,652,261	K178E	probably benign	Het
Tex10	T	A	4: 48,459,984	I456L	probably benign	Het
Tfcp2	A	G	15: 100,522,429	F175S	probably damaging	Het
Timp2	C	T	11: 118,303,800	A188T	probably damaging	Het
Tmc5	T	A	7: 118,669,217	I836N	probably damaging	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Ulk2	A	G	11: 61,854,552	Y9H	probably damaging	Het
Usp7	T	C	16: 8,705,163	K311E	probably damaging	Het
Vmn1r238	G	A	18: 3,123,033	T127I	probably benign	Het
Vmn2r28	T	C	7: 5,493,679	Y58C	probably damaging	Het
Wdr55	G	A	18: 36,760,416	G44S	probably benign	Het
Zfp677	C	A	17: 21,397,385	H235N	probably damaging	Het
Zfp869	T	A	8: 69,706,986	R312S	probably damaging	Het

Other mutations in Nav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Nav1	APN	1	135450630	missense	probably damaging	1.00
IGL01455:Nav1	APN	1	135469635	missense	probably benign	0.44
IGL01650:Nav1	APN	1	135454760	missense	probably damaging	1.00
IGL01872:Nav1	APN	1	135454076	missense	probably damaging	1.00
IGL01967:Nav1	APN	1	135537245	missense	probably damaging	1.00
IGL02167:Nav1	APN	1	135470961	missense	probably damaging	1.00
IGL02278:Nav1	APN	1	135463714	splice site	probably benign
IGL02343:Nav1	APN	1	135454752	nonsense	probably null
IGL02378:Nav1	APN	1	135469978	missense	probably benign	0.02
IGL02554:Nav1	APN	1	135584913	synonymous	silent
IGL03148:Nav1	APN	1	135470024	missense	possibly damaging	0.94
IGL03286:Nav1	APN	1	135454536	missense	probably benign
IGL03372:Nav1	APN	1	135450903	missense	probably damaging	0.99
PIT4802001:Nav1	UTSW	1	135452933	missense	unknown
R0388:Nav1	UTSW	1	135448917	splice site	probably benign
R0390:Nav1	UTSW	1	135449966	missense	possibly damaging	0.80
R0395:Nav1	UTSW	1	135532621	nonsense	probably null
R0395:Nav1	UTSW	1	135532623	missense	probably damaging	0.97
R0416:Nav1	UTSW	1	135471126	missense	possibly damaging	0.73
R0463:Nav1	UTSW	1	135452207	missense	possibly damaging	0.76
R0538:Nav1	UTSW	1	135464692	splice site	probably benign
R0594:Nav1	UTSW	1	135467643	missense	possibly damaging	0.74
R0696:Nav1	UTSW	1	135532614	missense	probably damaging	0.99
R0699:Nav1	UTSW	1	135452949	missense	probably benign	0.00
R0759:Nav1	UTSW	1	135455260	missense	possibly damaging	0.73
R1164:Nav1	UTSW	1	135472410	missense	probably benign
R1169:Nav1	UTSW	1	135455205	missense	probably damaging	1.00
R1401:Nav1	UTSW	1	135460425	missense	probably benign	0.20
R1421:Nav1	UTSW	1	135585010	missense	probably damaging	1.00
R1642:Nav1	UTSW	1	135452272	missense	probably damaging	1.00
R1705:Nav1	UTSW	1	135584599	missense	probably damaging	1.00
R1713:Nav1	UTSW	1	135595234	intron	probably benign
R1728:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1729:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1730:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1739:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1740:Nav1	UTSW	1	135458389	critical splice donor site	probably null
R1762:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1783:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1784:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1785:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1895:Nav1	UTSW	1	135458658	missense	probably damaging	1.00
R1896:Nav1	UTSW	1	135460737	missense	probably benign	0.00
R1901:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1902:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1925:Nav1	UTSW	1	135607229	utr 5 prime	probably benign
R1939:Nav1	UTSW	1	135465898	missense	probably damaging	1.00
R1971:Nav1	UTSW	1	135532353	missense	probably benign	0.06
R2063:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2066:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2084:Nav1	UTSW	1	135607420	unclassified	probably benign
R2090:Nav1	UTSW	1	135607165	utr 5 prime	probably benign
R2107:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2110:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2111:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2112:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2136:Nav1	UTSW	1	135454436	missense	probably null	0.18
R2268:Nav1	UTSW	1	135472236	nonsense	probably null
R2269:Nav1	UTSW	1	135472236	nonsense	probably null
R2847:Nav1	UTSW	1	135450644	splice site	probably null
R2869:Nav1	UTSW	1	135460757	synonymous	silent
R2871:Nav1	UTSW	1	135460757	synonymous	silent
R2872:Nav1	UTSW	1	135460757	synonymous	silent
R2904:Nav1	UTSW	1	135585238	missense	probably benign
R3690:Nav1	UTSW	1	135467644	missense	probably benign	0.11
R3716:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3717:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3718:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3815:Nav1	UTSW	1	135471124	missense	possibly damaging	0.95
R4282:Nav1	UTSW	1	135457913	intron	probably benign
R4361:Nav1	UTSW	1	135607437	unclassified	probably benign
R4610:Nav1	UTSW	1	135592448	intron	probably benign
R4730:Nav1	UTSW	1	135607311	unclassified	probably benign
R4784:Nav1	UTSW	1	135458739	missense	probably damaging	1.00
R4788:Nav1	UTSW	1	135469723	missense	probably benign
R4808:Nav1	UTSW	1	135455204	missense	probably damaging	1.00
R4996:Nav1	UTSW	1	135465971	missense	probably damaging	1.00
R5284:Nav1	UTSW	1	135449963	nonsense	probably null
R5514:Nav1	UTSW	1	135470561	missense	probably benign	0.04
R5769:Nav1	UTSW	1	135452257	missense	probably damaging	1.00
R5834:Nav1	UTSW	1	135532406	missense	probably benign	0.07
R5898:Nav1	UTSW	1	135585146	missense	probably benign
R6081:Nav1	UTSW	1	135470822	missense	probably damaging	1.00
R6344:Nav1	UTSW	1	135450796	missense	probably damaging	1.00
R6378:Nav1	UTSW	1	135454695	missense	probably damaging	1.00
R7001:Nav1	UTSW	1	135454611	splice site	probably null
R7185:Nav1	UTSW	1	135471008	missense	possibly damaging	0.85
R7291:Nav1	UTSW	1	135465859	missense	probably damaging	1.00
R7361:Nav1	UTSW	1	135452853	missense	unknown
R7390:Nav1	UTSW	1	135584918	missense	probably benign	0.01
R7464:Nav1	UTSW	1	135584909	missense	probably benign	0.03
R7502:Nav1	UTSW	1	135469666	missense	probably damaging	1.00
R7601:Nav1	UTSW	1	135460438	missense	unknown
R7625:Nav1	UTSW	1	135467745	missense	probably damaging	1.00
R7639:Nav1	UTSW	1	135471122	missense	probably benign	0.09
R7786:Nav1	UTSW	1	135469995	missense	probably damaging	1.00
R7815:Nav1	UTSW	1	135584639	missense	possibly damaging	0.49
R7825:Nav1	UTSW	1	135450044	missense	probably damaging	0.98
R8030:Nav1	UTSW	1	135537239	missense	probably damaging	1.00
R8370:Nav1	UTSW	1	135471144	nonsense	probably null
R8405:Nav1	UTSW	1	135454770	missense	unknown
R8720:Nav1	UTSW	1	135460726	missense	unknown
R8868:Nav1	UTSW	1	135585205	missense	probably benign	0.05
R8973:Nav1	UTSW	1	135584725	missense	probably benign	0.01
R9039:Nav1	UTSW	1	135443749	missense	unknown
R9261:Nav1	UTSW	1	135460357	missense	unknown
R9523:Nav1	UTSW	1	135452191	missense	unknown
Z1088:Nav1	UTSW	1	135470724	missense	probably benign	0.01
Z1176:Nav1	UTSW	1	135452886	missense	unknown
Z1176:Nav1	UTSW	1	135472420	missense	probably damaging	1.00
Z1177:Nav1	UTSW	1	135469731	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- CATGCTACTGGGGCAGGG -3'
(R):5'- CGATGGAGAAGCTCATTGGGT -3'

Sequencing Primer
(F):5'- TGGGTTACACAAGACCCTGACTG -3'
(R):5'- GCTGGTGAAGACTCATGCTCTC -3'

Posted On

2019-11-26