Mutagenetix > Incidental Mutation

Incidental Mutation 'R7808:Gabbr2'

600917

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R7808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46875744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 126 (H126L)

Ref Sequence

ENSEMBL: ENSMUSP00000103378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749]

AlphaFold

Q80T41

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107749
AA Change: H126L

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: H126L

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	T	C	2: 91,444,594		probably benign	Het
1700113H08Rik	T	C	10: 87,121,435	V11A	probably benign	Het
Abca12	A	T	1: 71,274,634		probably null	Het
Abcc12	T	A	8: 86,507,939	M1232L	probably benign	Het
Adamts1	T	C	16: 85,800,229	Y314C	probably damaging	Het
Adgb	A	G	10: 10,378,659		probably null	Het
Ankrd12	T	A	17: 65,985,653	K928N	possibly damaging	Het
Ano5	A	T	7: 51,587,795	K789I	possibly damaging	Het
Cacna1d	G	T	14: 30,111,069	N938K	probably damaging	Het
Camk1g	T	C	1: 193,350,285	R273G	possibly damaging	Het
Caprin2	C	A	6: 148,843,030	V966F	probably damaging	Het
Card6	T	C	15: 5,099,472	H814R	probably benign	Het
Ccdc84	T	C	9: 44,412,918	Q228R	probably null	Het
Cflar	A	G	1: 58,711,581		probably benign	Het
Cftr	T	A	6: 18,204,205	N66K	probably benign	Het
Clasrp	C	T	7: 19,588,746		probably null	Het
Clec4a4	T	C	6: 122,990,380	I5T	probably damaging	Het
Cmtr2	T	C	8: 110,221,619	I187T	possibly damaging	Het
Cnga1	A	T	5: 72,604,273	F633I	possibly damaging	Het
Col16a1	C	T	4: 130,073,264	P909S	unknown	Het
Csf1	C	A	3: 107,760,045	A7S	possibly damaging	Het
Dhx30	A	T	9: 110,086,202	V833D	probably benign	Het
Dlg2	T	G	7: 92,431,055	I712M	probably benign	Het
Dmxl1	T	A	18: 49,878,315	F1180I	probably benign	Het
Dnah9	T	A	11: 66,005,805	K2398*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Dync1h1	A	T	12: 110,655,459	N3412I	possibly damaging	Het
Dync1i2	T	A	2: 71,250,834		probably null	Het
Dysf	T	C	6: 84,070,929	S333P	possibly damaging	Het
Eed	A	T	7: 89,956,333	N349K	probably benign	Het
Eipr1	A	T	12: 28,766,770		probably null	Het
Fam160a2	G	A	7: 105,384,525	R509C	probably damaging	Het
Fbxw16	A	C	9: 109,448,154	V40G	probably damaging	Het
Fgfr4	A	C	13: 55,161,156	R363S	possibly damaging	Het
Fgl2	A	T	5: 21,373,231	N172I	possibly damaging	Het
Gcnt2	A	T	13: 40,860,862	N170Y	possibly damaging	Het
Gpt	A	G	15: 76,698,893		probably null	Het
Igsf10	A	G	3: 59,328,068	I1564T	probably benign	Het
Il22ra1	C	A	4: 135,750,796	Q393K	possibly damaging	Het
Inpp5d	A	T	1: 87,683,845	K340*	probably null	Het
Jcad	A	G	18: 4,673,113	K292E	probably damaging	Het
Krt5	T	A	15: 101,709,018	T427S	probably benign	Het
Krt76	T	C	15: 101,890,494	D252G	probably damaging	Het
Krtap26-1	A	G	16: 88,647,310	V141A	not run	Het
Lce6a	A	T	3: 92,620,335	V55D	probably benign	Het
Lpxn	C	T	19: 12,824,821	S170F	possibly damaging	Het
Magi2	T	C	5: 20,465,840	V394A	probably benign	Het
Mbnl1	G	A	3: 60,614,821		probably null	Het
Med16	T	A	10: 79,898,418	K554M	probably damaging	Het
Mettl14	T	C	3: 123,372,585	D276G	possibly damaging	Het
Mphosph9	T	C	5: 124,260,946	D1002G	probably damaging	Het
Mroh9	T	C	1: 163,039,109	E686G	probably damaging	Het
Nav1	T	C	1: 135,452,248	Y1512C	unknown	Het
Neb	T	C	2: 52,192,023	Y5712C	probably damaging	Het
Nek7	T	A	1: 138,561,771		probably benign	Het
Nptx1	T	A	11: 119,544,636	I285F	probably damaging	Het
Oas1d	G	T	5: 120,914,971	E30*	probably null	Het
Olfr404-ps1	A	T	11: 74,239,899	I112F	probably damaging	Het
Olfr429	C	A	1: 174,089,851	Y270*	probably null	Het
Olfr577	A	G	7: 102,973,110	V294A	possibly damaging	Het
Parp4	T	G	14: 56,635,748	S1150A	possibly damaging	Het
Pinx1	A	T	14: 63,919,292	K223*	probably null	Het
Plekha5	T	C	6: 140,583,914	L1034S	probably damaging	Het
Ppp4r3a	A	G	12: 101,053,496	V400A	possibly damaging	Het
Prtg	A	T	9: 72,842,697	I128F	possibly damaging	Het
Rars	T	C	11: 35,828,707	E96G	probably benign	Het
Rhpn1	T	A	15: 75,713,450	S551T	probably benign	Het
Selenow	C	T	7: 15,922,251		probably null	Het
Serpina9	A	T	12: 104,001,225		probably null	Het
Shank3	A	T	15: 89,548,880	D1276V	probably damaging	Het
Slc17a2	A	C	13: 23,819,334	H285P	probably damaging	Het
Slc27a6	A	G	18: 58,609,195	T494A	probably damaging	Het
Slc6a21	A	C	7: 45,282,936	T54P		Het
Syne2	A	G	12: 75,983,727		probably null	Het
Tal1	T	C	4: 115,068,292	V186A	probably benign	Het
Tarsl2	A	G	7: 65,652,261	K178E	probably benign	Het
Tex10	T	A	4: 48,459,984	I456L	probably benign	Het
Tfcp2	A	G	15: 100,522,429	F175S	probably damaging	Het
Timp2	C	T	11: 118,303,800	A188T	probably damaging	Het
Tmc5	T	A	7: 118,669,217	I836N	probably damaging	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Ulk2	A	G	11: 61,854,552	Y9H	probably damaging	Het
Usp7	T	C	16: 8,705,163	K311E	probably damaging	Het
Vmn1r238	G	A	18: 3,123,033	T127I	probably benign	Het
Vmn2r28	T	C	7: 5,493,679	Y58C	probably damaging	Het
Wdr55	G	A	18: 36,760,416	G44S	probably benign	Het
Zfp677	C	A	17: 21,397,385	H235N	probably damaging	Het
Zfp869	T	A	8: 69,706,986	R312S	probably damaging	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0882:Gabbr2	UTSW	4	46718904	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1004:Gabbr2	UTSW	4	46677544	missense	possibly damaging	0.60
R1078:Gabbr2	UTSW	4	46664833	missense	probably damaging	0.99
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R4798:Gabbr2	UTSW	4	46991139	missense	possibly damaging	0.92
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R5611:Gabbr2	UTSW	4	46804105	missense	probably damaging	0.98
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7832:Gabbr2	UTSW	4	46734096	missense	probably benign	0.04
R7993:Gabbr2	UTSW	4	46736349	splice site	probably null
R7994:Gabbr2	UTSW	4	46736349	splice site	probably null
R8051:Gabbr2	UTSW	4	46736349	splice site	probably null
R8084:Gabbr2	UTSW	4	46736349	splice site	probably null
R9050:Gabbr2	UTSW	4	46798659	missense	probably benign	0.03
R9187:Gabbr2	UTSW	4	46674533	missense	probably damaging	1.00
R9622:Gabbr2	UTSW	4	46724283	critical splice donor site	probably null
R9655:Gabbr2	UTSW	4	46815684	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TTGGTCAGGTCAGCATCGAG -3'
(R):5'- AACTGAAGTTTGTCTAAGGGTTTGC -3'

Sequencing Primer
(F):5'- TCAGCATCGAGGGTAGTGGC -3'
(R):5'- CCGTGATGGCAGGTTGATTG -3'

Posted On

2019-11-26