Incidental Mutation 'R7808:Mphosph9'
ID 600926
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene Name M-phase phosphoprotein 9
Synonyms MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7808 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124250959-124327972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124260946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1002 (D1002G)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031344
AA Change: D972G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: D972G

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect probably damaging
Transcript: ENSMUST00000184951
AA Change: D1002G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: D1002G

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Parp4 T G 14: 56,635,748 S1150A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124315418 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124320859 missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124315587 missense probably damaging 1.00
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124267111 missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124255106 missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124312722 missense probably benign 0.19
R8438:Mphosph9 UTSW 5 124292392 missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124312812 missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124315673 missense probably damaging 1.00
R8818:Mphosph9 UTSW 5 124324964 nonsense probably null
R8847:Mphosph9 UTSW 5 124316146 missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124298650 missense probably benign 0.12
R9208:Mphosph9 UTSW 5 124312791 missense probably damaging 0.97
R9221:Mphosph9 UTSW 5 124265364 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCTGTATAGAACTGTCTGGTG -3'
(R):5'- TTCCGTGCCAGCTTTGTCAG -3'

Sequencing Primer
(F):5'- ATAGAACTGTCTGGTGGTGACAATC -3'
(R):5'- AACCATGTGACTGTGAGCTC -3'
Posted On 2019-11-26