Mutagenetix > Incidental Mutation

Incidental Mutation 'R7808:Cftr'

600927

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R7808 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18204205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 66 (N66K)

Ref Sequence

ENSEMBL: ENSMUSP00000049228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]

AlphaFold

P26361

PDB Structure

mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000045706
AA Change: N66K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: N66K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115405
AA Change: N66K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: N66K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115406
AA Change: N66K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: N66K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129452
AA Change: N66K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: N66K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.9e-39	PFAM
Pfam:ABC_tran	441	528	5.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140407
AA Change: N66K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: N66K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	T	C	2: 91,444,594		probably benign	Het
1700113H08Rik	T	C	10: 87,121,435	V11A	probably benign	Het
Abca12	A	T	1: 71,274,634		probably null	Het
Abcc12	T	A	8: 86,507,939	M1232L	probably benign	Het
Adamts1	T	C	16: 85,800,229	Y314C	probably damaging	Het
Adgb	A	G	10: 10,378,659		probably null	Het
Ankrd12	T	A	17: 65,985,653	K928N	possibly damaging	Het
Ano5	A	T	7: 51,587,795	K789I	possibly damaging	Het
Cacna1d	G	T	14: 30,111,069	N938K	probably damaging	Het
Camk1g	T	C	1: 193,350,285	R273G	possibly damaging	Het
Caprin2	C	A	6: 148,843,030	V966F	probably damaging	Het
Card6	T	C	15: 5,099,472	H814R	probably benign	Het
Ccdc84	T	C	9: 44,412,918	Q228R	probably null	Het
Cflar	A	G	1: 58,711,581		probably benign	Het
Clasrp	C	T	7: 19,588,746		probably null	Het
Clec4a4	T	C	6: 122,990,380	I5T	probably damaging	Het
Cmtr2	T	C	8: 110,221,619	I187T	possibly damaging	Het
Cnga1	A	T	5: 72,604,273	F633I	possibly damaging	Het
Col16a1	C	T	4: 130,073,264	P909S	unknown	Het
Csf1	C	A	3: 107,760,045	A7S	possibly damaging	Het
Dhx30	A	T	9: 110,086,202	V833D	probably benign	Het
Dlg2	T	G	7: 92,431,055	I712M	probably benign	Het
Dmxl1	T	A	18: 49,878,315	F1180I	probably benign	Het
Dnah9	T	A	11: 66,005,805	K2398*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Dync1h1	A	T	12: 110,655,459	N3412I	possibly damaging	Het
Dync1i2	T	A	2: 71,250,834		probably null	Het
Dysf	T	C	6: 84,070,929	S333P	possibly damaging	Het
Eed	A	T	7: 89,956,333	N349K	probably benign	Het
Eipr1	A	T	12: 28,766,770		probably null	Het
Fam160a2	G	A	7: 105,384,525	R509C	probably damaging	Het
Fbxw16	A	C	9: 109,448,154	V40G	probably damaging	Het
Fgfr4	A	C	13: 55,161,156	R363S	possibly damaging	Het
Fgl2	A	T	5: 21,373,231	N172I	possibly damaging	Het
Gabbr2	T	A	4: 46,875,744	H126L	possibly damaging	Het
Gcnt2	A	T	13: 40,860,862	N170Y	possibly damaging	Het
Gpt	A	G	15: 76,698,893		probably null	Het
Igsf10	A	G	3: 59,328,068	I1564T	probably benign	Het
Il22ra1	C	A	4: 135,750,796	Q393K	possibly damaging	Het
Inpp5d	A	T	1: 87,683,845	K340*	probably null	Het
Jcad	A	G	18: 4,673,113	K292E	probably damaging	Het
Krt5	T	A	15: 101,709,018	T427S	probably benign	Het
Krt76	T	C	15: 101,890,494	D252G	probably damaging	Het
Krtap26-1	A	G	16: 88,647,310	V141A	not run	Het
Lce6a	A	T	3: 92,620,335	V55D	probably benign	Het
Lpxn	C	T	19: 12,824,821	S170F	possibly damaging	Het
Magi2	T	C	5: 20,465,840	V394A	probably benign	Het
Mbnl1	G	A	3: 60,614,821		probably null	Het
Med16	T	A	10: 79,898,418	K554M	probably damaging	Het
Mettl14	T	C	3: 123,372,585	D276G	possibly damaging	Het
Mphosph9	T	C	5: 124,260,946	D1002G	probably damaging	Het
Mroh9	T	C	1: 163,039,109	E686G	probably damaging	Het
Nav1	T	C	1: 135,452,248	Y1512C	unknown	Het
Neb	T	C	2: 52,192,023	Y5712C	probably damaging	Het
Nek7	T	A	1: 138,561,771		probably benign	Het
Nptx1	T	A	11: 119,544,636	I285F	probably damaging	Het
Oas1d	G	T	5: 120,914,971	E30*	probably null	Het
Olfr404-ps1	A	T	11: 74,239,899	I112F	probably damaging	Het
Olfr429	C	A	1: 174,089,851	Y270*	probably null	Het
Olfr577	A	G	7: 102,973,110	V294A	possibly damaging	Het
Parp4	T	G	14: 56,635,748	S1150A	possibly damaging	Het
Pinx1	A	T	14: 63,919,292	K223*	probably null	Het
Plekha5	T	C	6: 140,583,914	L1034S	probably damaging	Het
Ppp4r3a	A	G	12: 101,053,496	V400A	possibly damaging	Het
Prtg	A	T	9: 72,842,697	I128F	possibly damaging	Het
Rars	T	C	11: 35,828,707	E96G	probably benign	Het
Rhpn1	T	A	15: 75,713,450	S551T	probably benign	Het
Selenow	C	T	7: 15,922,251		probably null	Het
Serpina9	A	T	12: 104,001,225		probably null	Het
Shank3	A	T	15: 89,548,880	D1276V	probably damaging	Het
Slc17a2	A	C	13: 23,819,334	H285P	probably damaging	Het
Slc27a6	A	G	18: 58,609,195	T494A	probably damaging	Het
Slc6a21	A	C	7: 45,282,936	T54P		Het
Syne2	A	G	12: 75,983,727		probably null	Het
Tal1	T	C	4: 115,068,292	V186A	probably benign	Het
Tarsl2	A	G	7: 65,652,261	K178E	probably benign	Het
Tex10	T	A	4: 48,459,984	I456L	probably benign	Het
Tfcp2	A	G	15: 100,522,429	F175S	probably damaging	Het
Timp2	C	T	11: 118,303,800	A188T	probably damaging	Het
Tmc5	T	A	7: 118,669,217	I836N	probably damaging	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Ulk2	A	G	11: 61,854,552	Y9H	probably damaging	Het
Usp7	T	C	16: 8,705,163	K311E	probably damaging	Het
Vmn1r238	G	A	18: 3,123,033	T127I	probably benign	Het
Vmn2r28	T	C	7: 5,493,679	Y58C	probably damaging	Het
Wdr55	G	A	18: 36,760,416	G44S	probably benign	Het
Zfp677	C	A	17: 21,397,385	H235N	probably damaging	Het
Zfp869	T	A	8: 69,706,986	R312S	probably damaging	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00
R9689:Cftr	UTSW	6	18313650	missense	probably damaging	0.99
R9700:Cftr	UTSW	6	18268360	missense	probably damaging	1.00
R9747:Cftr	UTSW	6	18285637	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- ACAGAGTGATTTCATGGAAGACC -3'
(R):5'- TTTGGTTACAAGATTGTCCTCACC -3'

Sequencing Primer
(F):5'- TTGGTACTGGAGCAACTTCAC -3'
(R):5'- ACCCTTCTGTAATCACAAAACTATG -3'

Posted On

2019-11-26