Incidental Mutation 'R7808:Fhip1b'
ID 600940
Institutional Source Beutler Lab
Gene Symbol Fhip1b
Ensembl Gene ENSMUSG00000044465
Gene Name FHF complex subunit HOOK interacting protein 1B
Synonyms Fam160a2, 4632419K20Rik, 6530415H11Rik
MMRRC Submission 045863-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7808 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105020418-105049261 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 105033732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 509 (R509C)
Ref Sequence ENSEMBL: ENSMUSP00000045084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474] [ENSMUST00000210448] [ENSMUST00000211549]
AlphaFold Q3U2I3
Predicted Effect probably damaging
Transcript: ENSMUST00000048079
AA Change: R509C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: R509C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118726
AA Change: R509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: R509C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122327
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137158
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179474
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210448
Predicted Effect probably benign
Transcript: ENSMUST00000211549
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 86,957,297 (GRCm39) V11A probably benign Het
Abca12 A T 1: 71,313,793 (GRCm39) probably null Het
Abcc12 T A 8: 87,234,568 (GRCm39) M1232L probably benign Het
Adamts1 T C 16: 85,597,117 (GRCm39) Y314C probably damaging Het
Adgb A G 10: 10,254,403 (GRCm39) probably null Het
Ankrd12 T A 17: 66,292,648 (GRCm39) K928N possibly damaging Het
Ano5 A T 7: 51,237,543 (GRCm39) K789I possibly damaging Het
Cacna1d G T 14: 29,833,026 (GRCm39) N938K probably damaging Het
Camk1g T C 1: 193,032,593 (GRCm39) R273G possibly damaging Het
Caprin2 C A 6: 148,744,528 (GRCm39) V966F probably damaging Het
Card6 T C 15: 5,128,954 (GRCm39) H814R probably benign Het
Cenatac T C 9: 44,324,215 (GRCm39) Q228R probably null Het
Cflar A G 1: 58,750,740 (GRCm39) probably benign Het
Cftr T A 6: 18,204,204 (GRCm39) N66K probably benign Het
Clasrp C T 7: 19,322,671 (GRCm39) probably null Het
Clec4a4 T C 6: 122,967,339 (GRCm39) I5T probably damaging Het
Cmtr2 T C 8: 110,948,251 (GRCm39) I187T possibly damaging Het
Cnga1 A T 5: 72,761,616 (GRCm39) F633I possibly damaging Het
Col16a1 C T 4: 129,967,057 (GRCm39) P909S unknown Het
Csf1 C A 3: 107,667,361 (GRCm39) A7S possibly damaging Het
Cstpp1 T C 2: 91,274,939 (GRCm39) probably benign Het
Dhx30 A T 9: 109,915,270 (GRCm39) V833D probably benign Het
Dlg2 T G 7: 92,080,263 (GRCm39) I712M probably benign Het
Dmxl1 T A 18: 50,011,382 (GRCm39) F1180I probably benign Het
Dnah9 T A 11: 65,896,631 (GRCm39) K2398* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Dync1h1 A T 12: 110,621,893 (GRCm39) N3412I possibly damaging Het
Dync1i2 T A 2: 71,081,178 (GRCm39) probably null Het
Dysf T C 6: 84,047,911 (GRCm39) S333P possibly damaging Het
Eed A T 7: 89,605,541 (GRCm39) N349K probably benign Het
Eipr1 A T 12: 28,816,769 (GRCm39) probably null Het
Fbxw16 A C 9: 109,277,222 (GRCm39) V40G probably damaging Het
Fgfr4 A C 13: 55,308,969 (GRCm39) R363S possibly damaging Het
Fgl2 A T 5: 21,578,229 (GRCm39) N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 (GRCm39) H126L possibly damaging Het
Gcnt2 A T 13: 41,014,338 (GRCm39) N170Y possibly damaging Het
Gpt A G 15: 76,583,093 (GRCm39) probably null Het
Igsf10 A G 3: 59,235,489 (GRCm39) I1564T probably benign Het
Il22ra1 C A 4: 135,478,107 (GRCm39) Q393K possibly damaging Het
Inpp5d A T 1: 87,611,567 (GRCm39) K340* probably null Het
Jcad A G 18: 4,673,113 (GRCm39) K292E probably damaging Het
Krt5 T A 15: 101,617,453 (GRCm39) T427S probably benign Het
Krt76 T C 15: 101,798,929 (GRCm39) D252G probably damaging Het
Krtap26-1 A G 16: 88,444,198 (GRCm39) V141A not run Het
Lce6a A T 3: 92,527,642 (GRCm39) V55D probably benign Het
Lpxn C T 19: 12,802,185 (GRCm39) S170F possibly damaging Het
Magi2 T C 5: 20,670,838 (GRCm39) V394A probably benign Het
Mbnl1 G A 3: 60,522,242 (GRCm39) probably null Het
Med16 T A 10: 79,734,252 (GRCm39) K554M probably damaging Het
Mettl14 T C 3: 123,166,234 (GRCm39) D276G possibly damaging Het
Mphosph9 T C 5: 124,399,009 (GRCm39) D1002G probably damaging Het
Mroh9 T C 1: 162,866,678 (GRCm39) E686G probably damaging Het
Nav1 T C 1: 135,379,986 (GRCm39) Y1512C unknown Het
Neb T C 2: 52,082,035 (GRCm39) Y5712C probably damaging Het
Nek7 T A 1: 138,489,509 (GRCm39) probably benign Het
Nptx1 T A 11: 119,435,462 (GRCm39) I285F probably damaging Het
Oas1d G T 5: 121,053,034 (GRCm39) E30* probably null Het
Or1p1b A T 11: 74,130,725 (GRCm39) I112F probably damaging Het
Or51g2 A G 7: 102,622,317 (GRCm39) V294A possibly damaging Het
Or6n1 C A 1: 173,917,417 (GRCm39) Y270* probably null Het
Parp4 T G 14: 56,873,205 (GRCm39) S1150A possibly damaging Het
Pinx1 A T 14: 64,156,741 (GRCm39) K223* probably null Het
Plekha5 T C 6: 140,529,640 (GRCm39) L1034S probably damaging Het
Ppp4r3a A G 12: 101,019,755 (GRCm39) V400A possibly damaging Het
Prtg A T 9: 72,749,979 (GRCm39) I128F possibly damaging Het
Rars1 T C 11: 35,719,534 (GRCm39) E96G probably benign Het
Rhpn1 T A 15: 75,585,299 (GRCm39) S551T probably benign Het
Selenow C T 7: 15,656,176 (GRCm39) probably null Het
Serpina9 A T 12: 103,967,484 (GRCm39) probably null Het
Shank3 A T 15: 89,433,083 (GRCm39) D1276V probably damaging Het
Slc27a6 A G 18: 58,742,267 (GRCm39) T494A probably damaging Het
Slc34a1 A C 13: 24,003,317 (GRCm39) H285P probably damaging Het
Slc6a21 A C 7: 44,932,360 (GRCm39) T54P Het
Syne2 A G 12: 76,030,501 (GRCm39) probably null Het
Tal1 T C 4: 114,925,489 (GRCm39) V186A probably benign Het
Tars3 A G 7: 65,302,009 (GRCm39) K178E probably benign Het
Tex10 T A 4: 48,459,984 (GRCm39) I456L probably benign Het
Tfcp2 A G 15: 100,420,310 (GRCm39) F175S probably damaging Het
Timp2 C T 11: 118,194,626 (GRCm39) A188T probably damaging Het
Tmc5 T A 7: 118,268,440 (GRCm39) I836N probably damaging Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Ulk2 A G 11: 61,745,378 (GRCm39) Y9H probably damaging Het
Usp7 T C 16: 8,523,027 (GRCm39) K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 (GRCm39) T127I probably benign Het
Vmn2r28 T C 7: 5,496,678 (GRCm39) Y58C probably damaging Het
Wdr55 G A 18: 36,893,469 (GRCm39) G44S probably benign Het
Zfp677 C A 17: 21,617,647 (GRCm39) H235N probably damaging Het
Zfp869 T A 8: 70,159,636 (GRCm39) R312S probably damaging Het
Other mutations in Fhip1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fhip1b APN 7 105,037,467 (GRCm39) missense probably damaging 1.00
IGL01972:Fhip1b APN 7 105,039,352 (GRCm39) missense probably damaging 0.99
IGL02054:Fhip1b APN 7 105,033,630 (GRCm39) missense probably damaging 1.00
IGL03037:Fhip1b APN 7 105,028,293 (GRCm39) missense probably benign 0.04
IGL03278:Fhip1b APN 7 105,034,331 (GRCm39) missense possibly damaging 0.93
IGL03340:Fhip1b APN 7 105,038,517 (GRCm39) missense probably damaging 1.00
IGL03374:Fhip1b APN 7 105,033,158 (GRCm39) missense probably damaging 1.00
R0426:Fhip1b UTSW 7 105,038,680 (GRCm39) missense probably damaging 1.00
R0482:Fhip1b UTSW 7 105,033,419 (GRCm39) missense possibly damaging 0.87
R0586:Fhip1b UTSW 7 105,038,654 (GRCm39) missense probably damaging 1.00
R0686:Fhip1b UTSW 7 105,037,516 (GRCm39) missense probably damaging 1.00
R1617:Fhip1b UTSW 7 105,034,269 (GRCm39) missense probably damaging 1.00
R2025:Fhip1b UTSW 7 105,038,143 (GRCm39) missense probably damaging 1.00
R2042:Fhip1b UTSW 7 105,033,328 (GRCm39) nonsense probably null
R2049:Fhip1b UTSW 7 105,039,046 (GRCm39) missense probably damaging 1.00
R2201:Fhip1b UTSW 7 105,037,398 (GRCm39) missense probably damaging 1.00
R3778:Fhip1b UTSW 7 105,037,435 (GRCm39) missense probably damaging 1.00
R4094:Fhip1b UTSW 7 105,037,425 (GRCm39) missense probably damaging 1.00
R4348:Fhip1b UTSW 7 105,034,556 (GRCm39) missense probably damaging 1.00
R4482:Fhip1b UTSW 7 105,038,881 (GRCm39) missense probably benign 0.06
R4609:Fhip1b UTSW 7 105,037,431 (GRCm39) missense probably damaging 1.00
R4742:Fhip1b UTSW 7 105,033,518 (GRCm39) missense probably damaging 0.99
R4977:Fhip1b UTSW 7 105,038,542 (GRCm39) missense probably damaging 1.00
R5642:Fhip1b UTSW 7 105,039,089 (GRCm39) missense probably damaging 1.00
R6404:Fhip1b UTSW 7 105,034,198 (GRCm39) nonsense probably null
R6906:Fhip1b UTSW 7 105,037,476 (GRCm39) missense probably damaging 1.00
R7053:Fhip1b UTSW 7 105,033,779 (GRCm39) missense probably damaging 1.00
R7265:Fhip1b UTSW 7 105,033,432 (GRCm39) missense probably benign 0.00
R8246:Fhip1b UTSW 7 105,038,867 (GRCm39) missense probably damaging 0.98
R8253:Fhip1b UTSW 7 105,028,294 (GRCm39) missense possibly damaging 0.54
R8379:Fhip1b UTSW 7 105,034,342 (GRCm39) missense possibly damaging 0.65
R8497:Fhip1b UTSW 7 105,030,396 (GRCm39) missense probably damaging 1.00
R8919:Fhip1b UTSW 7 105,037,477 (GRCm39) missense possibly damaging 0.48
R9093:Fhip1b UTSW 7 105,034,599 (GRCm39) missense probably damaging 0.98
R9176:Fhip1b UTSW 7 105,030,585 (GRCm39) missense probably benign 0.33
R9215:Fhip1b UTSW 7 105,034,296 (GRCm39) missense possibly damaging 0.95
R9244:Fhip1b UTSW 7 105,038,870 (GRCm39) missense possibly damaging 0.68
R9447:Fhip1b UTSW 7 105,034,155 (GRCm39) missense probably benign
R9554:Fhip1b UTSW 7 105,038,915 (GRCm39) missense probably damaging 0.98
X0022:Fhip1b UTSW 7 105,038,916 (GRCm39) nonsense probably null
Z1190:Fhip1b UTSW 7 105,037,528 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTAATTGTCTTCTAGCTCACC -3'
(R):5'- ATTTCATTCATGAAGGCGGTGAG -3'

Sequencing Primer
(F):5'- AGCTCACCAGGCTCCTCTG -3'
(R):5'- TTAGTCTAGAGATTGGAGAGTCACC -3'
Posted On 2019-11-26