Incidental Mutation 'R7808:Fam160a2'
ID600940
Institutional Source Beutler Lab
Gene Symbol Fam160a2
Ensembl Gene ENSMUSG00000044465
Gene Namefamily with sequence similarity 160, member A2
Synonyms4632419K20Rik, 6530415H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7808 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105371211-105400054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105384525 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 509 (R509C)
Ref Sequence ENSEMBL: ENSMUSP00000045084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474] [ENSMUST00000210448] [ENSMUST00000211549]
Predicted Effect probably damaging
Transcript: ENSMUST00000048079
AA Change: R509C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: R509C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118726
AA Change: R509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: R509C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122327
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137158
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179474
AA Change: R495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: R495C

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210448
Predicted Effect probably benign
Transcript: ENSMUST00000211549
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Parp4 T G 14: 56,635,748 S1150A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Fam160a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fam160a2 APN 7 105388260 missense probably damaging 1.00
IGL01972:Fam160a2 APN 7 105390145 missense probably damaging 0.99
IGL02054:Fam160a2 APN 7 105384423 missense probably damaging 1.00
IGL03037:Fam160a2 APN 7 105379086 missense probably benign 0.04
IGL03278:Fam160a2 APN 7 105385124 missense possibly damaging 0.93
IGL03340:Fam160a2 APN 7 105389310 missense probably damaging 1.00
IGL03374:Fam160a2 APN 7 105383951 missense probably damaging 1.00
R0426:Fam160a2 UTSW 7 105389473 missense probably damaging 1.00
R0482:Fam160a2 UTSW 7 105384212 missense possibly damaging 0.87
R0586:Fam160a2 UTSW 7 105389447 missense probably damaging 1.00
R0686:Fam160a2 UTSW 7 105388309 missense probably damaging 1.00
R1617:Fam160a2 UTSW 7 105385062 missense probably damaging 1.00
R2025:Fam160a2 UTSW 7 105388936 missense probably damaging 1.00
R2042:Fam160a2 UTSW 7 105384121 nonsense probably null
R2049:Fam160a2 UTSW 7 105389839 missense probably damaging 1.00
R2201:Fam160a2 UTSW 7 105388191 missense probably damaging 1.00
R3778:Fam160a2 UTSW 7 105388228 missense probably damaging 1.00
R4094:Fam160a2 UTSW 7 105388218 missense probably damaging 1.00
R4348:Fam160a2 UTSW 7 105385349 missense probably damaging 1.00
R4482:Fam160a2 UTSW 7 105389674 missense probably benign 0.06
R4609:Fam160a2 UTSW 7 105388224 missense probably damaging 1.00
R4742:Fam160a2 UTSW 7 105384311 missense probably damaging 0.99
R4977:Fam160a2 UTSW 7 105389335 missense probably damaging 1.00
R5642:Fam160a2 UTSW 7 105389882 missense probably damaging 1.00
R6404:Fam160a2 UTSW 7 105384991 nonsense probably null
R6906:Fam160a2 UTSW 7 105388269 missense probably damaging 1.00
R7053:Fam160a2 UTSW 7 105384572 missense probably damaging 1.00
R7265:Fam160a2 UTSW 7 105384225 missense probably benign 0.00
R8246:Fam160a2 UTSW 7 105389660 missense probably damaging 0.98
R8253:Fam160a2 UTSW 7 105379087 missense possibly damaging 0.54
R8379:Fam160a2 UTSW 7 105385135 missense possibly damaging 0.65
R8497:Fam160a2 UTSW 7 105381189 missense probably damaging 1.00
X0022:Fam160a2 UTSW 7 105389709 nonsense probably null
Z1190:Fam160a2 UTSW 7 105388321 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTAATTGTCTTCTAGCTCACC -3'
(R):5'- ATTTCATTCATGAAGGCGGTGAG -3'

Sequencing Primer
(F):5'- AGCTCACCAGGCTCCTCTG -3'
(R):5'- TTAGTCTAGAGATTGGAGAGTCACC -3'
Posted On2019-11-26