Incidental Mutation 'R7808:Ulk2'
ID600952
Institutional Source Beutler Lab
Gene Symbol Ulk2
Ensembl Gene ENSMUSG00000004798
Gene Nameunc-51 like kinase 2
SynonymsUnc51.2, A830085I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R7808 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61775649-61855073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61854552 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 9 (Y9H)
Ref Sequence ENSEMBL: ENSMUSP00000004920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004920]
Predicted Effect probably damaging
Transcript: ENSMUST00000004920
AA Change: Y9H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798
AA Change: Y9H

DomainStartEndE-ValueType
S_TKc 9 271 1.1e-93 SMART
low complexity region 274 309 N/A INTRINSIC
Blast:S_TKc 310 413 9e-28 BLAST
Blast:S_TKc 433 738 1e-29 BLAST
low complexity region 751 766 N/A INTRINSIC
low complexity region 771 791 N/A INTRINSIC
Pfam:DUF3543 821 1032 1.8e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Parp4 T G 14: 56,635,748 S1150A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Ulk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ulk2 APN 11 61791436 nonsense probably null
IGL02044:Ulk2 APN 11 61781639 missense probably damaging 1.00
IGL02185:Ulk2 APN 11 61782060 missense probably damaging 1.00
IGL03036:Ulk2 APN 11 61834834 missense probably damaging 1.00
BB007:Ulk2 UTSW 11 61791432 critical splice donor site probably null
BB009:Ulk2 UTSW 11 61808090 missense probably benign
BB017:Ulk2 UTSW 11 61791432 critical splice donor site probably null
BB019:Ulk2 UTSW 11 61808090 missense probably benign
R0207:Ulk2 UTSW 11 61777785 missense probably benign 0.42
R0362:Ulk2 UTSW 11 61787586 missense probably benign
R0657:Ulk2 UTSW 11 61808054 splice site probably benign
R1076:Ulk2 UTSW 11 61819309 missense probably damaging 1.00
R1144:Ulk2 UTSW 11 61800060 missense possibly damaging 0.80
R1573:Ulk2 UTSW 11 61779755 missense probably damaging 1.00
R1583:Ulk2 UTSW 11 61783545 missense possibly damaging 0.95
R1619:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R1757:Ulk2 UTSW 11 61841339 splice site probably benign
R1845:Ulk2 UTSW 11 61812738 missense probably benign 0.04
R1883:Ulk2 UTSW 11 61830612 missense probably damaging 1.00
R1966:Ulk2 UTSW 11 61819471 splice site probably null
R2177:Ulk2 UTSW 11 61791509 missense probably benign 0.01
R2416:Ulk2 UTSW 11 61782039 missense probably damaging 1.00
R2509:Ulk2 UTSW 11 61787514 missense probably benign 0.00
R2847:Ulk2 UTSW 11 61824729 critical splice acceptor site probably null
R4736:Ulk2 UTSW 11 61833435 missense probably damaging 1.00
R4997:Ulk2 UTSW 11 61799156 missense probably benign 0.00
R5081:Ulk2 UTSW 11 61803662 missense probably damaging 1.00
R5190:Ulk2 UTSW 11 61781711 missense probably benign
R5346:Ulk2 UTSW 11 61834914 missense probably damaging 1.00
R5348:Ulk2 UTSW 11 61783613 missense probably benign
R5520:Ulk2 UTSW 11 61808144 missense probably damaging 1.00
R5954:Ulk2 UTSW 11 61803796 splice site probably benign
R6153:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R6223:Ulk2 UTSW 11 61787504 nonsense probably null
R7204:Ulk2 UTSW 11 61783631 missense probably benign 0.11
R7205:Ulk2 UTSW 11 61834831 missense possibly damaging 0.84
R7259:Ulk2 UTSW 11 61782083 missense probably damaging 1.00
R7353:Ulk2 UTSW 11 61819348 missense probably damaging 1.00
R7734:Ulk2 UTSW 11 61853301 nonsense probably null
R7797:Ulk2 UTSW 11 61782102 missense probably benign 0.06
R7930:Ulk2 UTSW 11 61791432 critical splice donor site probably null
R7932:Ulk2 UTSW 11 61808090 missense probably benign
R8882:Ulk2 UTSW 11 61808061 critical splice donor site probably null
R8909:Ulk2 UTSW 11 61799554 missense probably benign
X0028:Ulk2 UTSW 11 61799568 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACATCAGTGGCTCTGC -3'
(R):5'- TCTCGGCATGAGTGTCCATC -3'

Sequencing Primer
(F):5'- TAGGTGGAGCTCAGCCTAG -3'
(R):5'- ATGAGTGTCCATCCGGGC -3'
Posted On2019-11-26