Incidental Mutation 'R7808:Slc34a1'
ID 600962
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Slc17a2, Npt2, Na/Pi cotransporter, renal Na+/Pi transporter, NaPi-IIa
MMRRC Submission 045863-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7808 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55547435-55562508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 24003317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 285 (H285P)
Ref Sequence ENSEMBL: ENSMUSP00000006786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006786
AA Change: H285P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: H285P

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099697
AA Change: H285P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: H285P

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Meta Mutation Damage Score 0.4403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 86,957,297 (GRCm39) V11A probably benign Het
Abca12 A T 1: 71,313,793 (GRCm39) probably null Het
Abcc12 T A 8: 87,234,568 (GRCm39) M1232L probably benign Het
Adamts1 T C 16: 85,597,117 (GRCm39) Y314C probably damaging Het
Adgb A G 10: 10,254,403 (GRCm39) probably null Het
Ankrd12 T A 17: 66,292,648 (GRCm39) K928N possibly damaging Het
Ano5 A T 7: 51,237,543 (GRCm39) K789I possibly damaging Het
Cacna1d G T 14: 29,833,026 (GRCm39) N938K probably damaging Het
Camk1g T C 1: 193,032,593 (GRCm39) R273G possibly damaging Het
Caprin2 C A 6: 148,744,528 (GRCm39) V966F probably damaging Het
Card6 T C 15: 5,128,954 (GRCm39) H814R probably benign Het
Cenatac T C 9: 44,324,215 (GRCm39) Q228R probably null Het
Cflar A G 1: 58,750,740 (GRCm39) probably benign Het
Cftr T A 6: 18,204,204 (GRCm39) N66K probably benign Het
Clasrp C T 7: 19,322,671 (GRCm39) probably null Het
Clec4a4 T C 6: 122,967,339 (GRCm39) I5T probably damaging Het
Cmtr2 T C 8: 110,948,251 (GRCm39) I187T possibly damaging Het
Cnga1 A T 5: 72,761,616 (GRCm39) F633I possibly damaging Het
Col16a1 C T 4: 129,967,057 (GRCm39) P909S unknown Het
Csf1 C A 3: 107,667,361 (GRCm39) A7S possibly damaging Het
Cstpp1 T C 2: 91,274,939 (GRCm39) probably benign Het
Dhx30 A T 9: 109,915,270 (GRCm39) V833D probably benign Het
Dlg2 T G 7: 92,080,263 (GRCm39) I712M probably benign Het
Dmxl1 T A 18: 50,011,382 (GRCm39) F1180I probably benign Het
Dnah9 T A 11: 65,896,631 (GRCm39) K2398* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Dync1h1 A T 12: 110,621,893 (GRCm39) N3412I possibly damaging Het
Dync1i2 T A 2: 71,081,178 (GRCm39) probably null Het
Dysf T C 6: 84,047,911 (GRCm39) S333P possibly damaging Het
Eed A T 7: 89,605,541 (GRCm39) N349K probably benign Het
Eipr1 A T 12: 28,816,769 (GRCm39) probably null Het
Fbxw16 A C 9: 109,277,222 (GRCm39) V40G probably damaging Het
Fgfr4 A C 13: 55,308,969 (GRCm39) R363S possibly damaging Het
Fgl2 A T 5: 21,578,229 (GRCm39) N172I possibly damaging Het
Fhip1b G A 7: 105,033,732 (GRCm39) R509C probably damaging Het
Gabbr2 T A 4: 46,875,744 (GRCm39) H126L possibly damaging Het
Gcnt2 A T 13: 41,014,338 (GRCm39) N170Y possibly damaging Het
Gpt A G 15: 76,583,093 (GRCm39) probably null Het
Igsf10 A G 3: 59,235,489 (GRCm39) I1564T probably benign Het
Il22ra1 C A 4: 135,478,107 (GRCm39) Q393K possibly damaging Het
Inpp5d A T 1: 87,611,567 (GRCm39) K340* probably null Het
Jcad A G 18: 4,673,113 (GRCm39) K292E probably damaging Het
Krt5 T A 15: 101,617,453 (GRCm39) T427S probably benign Het
Krt76 T C 15: 101,798,929 (GRCm39) D252G probably damaging Het
Krtap26-1 A G 16: 88,444,198 (GRCm39) V141A not run Het
Lce6a A T 3: 92,527,642 (GRCm39) V55D probably benign Het
Lpxn C T 19: 12,802,185 (GRCm39) S170F possibly damaging Het
Magi2 T C 5: 20,670,838 (GRCm39) V394A probably benign Het
Mbnl1 G A 3: 60,522,242 (GRCm39) probably null Het
Med16 T A 10: 79,734,252 (GRCm39) K554M probably damaging Het
Mettl14 T C 3: 123,166,234 (GRCm39) D276G possibly damaging Het
Mphosph9 T C 5: 124,399,009 (GRCm39) D1002G probably damaging Het
Mroh9 T C 1: 162,866,678 (GRCm39) E686G probably damaging Het
Nav1 T C 1: 135,379,986 (GRCm39) Y1512C unknown Het
Neb T C 2: 52,082,035 (GRCm39) Y5712C probably damaging Het
Nek7 T A 1: 138,489,509 (GRCm39) probably benign Het
Nptx1 T A 11: 119,435,462 (GRCm39) I285F probably damaging Het
Oas1d G T 5: 121,053,034 (GRCm39) E30* probably null Het
Or1p1b A T 11: 74,130,725 (GRCm39) I112F probably damaging Het
Or51g2 A G 7: 102,622,317 (GRCm39) V294A possibly damaging Het
Or6n1 C A 1: 173,917,417 (GRCm39) Y270* probably null Het
Parp4 T G 14: 56,873,205 (GRCm39) S1150A possibly damaging Het
Pinx1 A T 14: 64,156,741 (GRCm39) K223* probably null Het
Plekha5 T C 6: 140,529,640 (GRCm39) L1034S probably damaging Het
Ppp4r3a A G 12: 101,019,755 (GRCm39) V400A possibly damaging Het
Prtg A T 9: 72,749,979 (GRCm39) I128F possibly damaging Het
Rars1 T C 11: 35,719,534 (GRCm39) E96G probably benign Het
Rhpn1 T A 15: 75,585,299 (GRCm39) S551T probably benign Het
Selenow C T 7: 15,656,176 (GRCm39) probably null Het
Serpina9 A T 12: 103,967,484 (GRCm39) probably null Het
Shank3 A T 15: 89,433,083 (GRCm39) D1276V probably damaging Het
Slc27a6 A G 18: 58,742,267 (GRCm39) T494A probably damaging Het
Slc6a21 A C 7: 44,932,360 (GRCm39) T54P Het
Syne2 A G 12: 76,030,501 (GRCm39) probably null Het
Tal1 T C 4: 114,925,489 (GRCm39) V186A probably benign Het
Tars3 A G 7: 65,302,009 (GRCm39) K178E probably benign Het
Tex10 T A 4: 48,459,984 (GRCm39) I456L probably benign Het
Tfcp2 A G 15: 100,420,310 (GRCm39) F175S probably damaging Het
Timp2 C T 11: 118,194,626 (GRCm39) A188T probably damaging Het
Tmc5 T A 7: 118,268,440 (GRCm39) I836N probably damaging Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Ulk2 A G 11: 61,745,378 (GRCm39) Y9H probably damaging Het
Usp7 T C 16: 8,523,027 (GRCm39) K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 (GRCm39) T127I probably benign Het
Vmn2r28 T C 7: 5,496,678 (GRCm39) Y58C probably damaging Het
Wdr55 G A 18: 36,893,469 (GRCm39) G44S probably benign Het
Zfp677 C A 17: 21,617,647 (GRCm39) H235N probably damaging Het
Zfp869 T A 8: 70,159,636 (GRCm39) R312S probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc34a1 APN 13 24,003,317 (GRCm39) missense probably benign 0.13
IGL01120:Slc34a1 APN 13 55,556,884 (GRCm39) missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55,550,546 (GRCm39) missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55,559,941 (GRCm39) missense probably damaging 1.00
IGL01511:Slc34a1 APN 13 24,003,121 (GRCm39) critical splice donor site probably null
IGL01624:Slc34a1 APN 13 23,998,969 (GRCm39) missense probably benign 0.00
IGL01839:Slc34a1 APN 13 23,996,668 (GRCm39) missense possibly damaging 0.91
IGL02010:Slc34a1 APN 13 24,003,025 (GRCm39) missense probably benign 0.00
IGL02525:Slc34a1 APN 13 55,551,051 (GRCm39) splice site probably benign
IGL02555:Slc34a1 APN 13 55,548,981 (GRCm39) missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55,551,049 (GRCm39) splice site probably benign
IGL03173:Slc34a1 APN 13 55,561,089 (GRCm39) missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55,548,591 (GRCm39) missense probably benign 0.00
IGL03299:Slc34a1 APN 13 24,005,094 (GRCm39) critical splice donor site probably null
Rockies UTSW 13 24,003,317 (GRCm39) missense probably damaging 0.99
R0190:Slc34a1 UTSW 13 55,556,914 (GRCm39) missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55,560,078 (GRCm39) missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55,550,711 (GRCm39) splice site probably null
R0622:Slc34a1 UTSW 13 23,996,594 (GRCm39) missense probably damaging 1.00
R1055:Slc34a1 UTSW 13 55,550,846 (GRCm39) missense probably benign 0.26
R1104:Slc34a1 UTSW 13 24,003,920 (GRCm39) missense probably damaging 0.99
R1243:Slc34a1 UTSW 13 55,559,944 (GRCm39) missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55,548,524 (GRCm39) missense probably benign
R1530:Slc34a1 UTSW 13 24,003,052 (GRCm39) missense probably damaging 1.00
R1566:Slc34a1 UTSW 13 55,559,844 (GRCm39) critical splice acceptor site probably null
R1682:Slc34a1 UTSW 13 23,996,623 (GRCm39) missense probably damaging 0.96
R1732:Slc34a1 UTSW 13 55,561,233 (GRCm39) missense probably benign
R1901:Slc34a1 UTSW 13 55,548,963 (GRCm39) nonsense probably null
R2255:Slc34a1 UTSW 13 24,004,991 (GRCm39) missense probably benign 0.09
R2423:Slc34a1 UTSW 13 55,556,865 (GRCm39) missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55,551,142 (GRCm39) missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55,560,983 (GRCm39) missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55,550,474 (GRCm39) splice site probably benign
R4553:Slc34a1 UTSW 13 55,559,874 (GRCm39) splice site probably null
R4735:Slc34a1 UTSW 13 55,561,397 (GRCm39) missense probably benign 0.13
R4923:Slc34a1 UTSW 13 24,003,078 (GRCm39) missense probably benign 0.20
R5177:Slc34a1 UTSW 13 55,548,975 (GRCm39) missense probably damaging 0.99
R5193:Slc34a1 UTSW 13 24,003,845 (GRCm39) critical splice acceptor site probably null
R5321:Slc34a1 UTSW 13 23,996,614 (GRCm39) missense possibly damaging 0.95
R5334:Slc34a1 UTSW 13 24,003,034 (GRCm39) missense probably damaging 0.97
R5345:Slc34a1 UTSW 13 55,548,331 (GRCm39) missense probably benign
R5363:Slc34a1 UTSW 13 55,560,103 (GRCm39) missense probably damaging 1.00
R5363:Slc34a1 UTSW 13 55,551,081 (GRCm39) missense probably benign 0.16
R5377:Slc34a1 UTSW 13 23,996,575 (GRCm39) missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55,556,898 (GRCm39) missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55,549,085 (GRCm39) critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55,550,501 (GRCm39) missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55,561,278 (GRCm39) missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55,559,884 (GRCm39) missense probably damaging 1.00
R6165:Slc34a1 UTSW 13 23,999,053 (GRCm39) missense probably benign 0.00
R6280:Slc34a1 UTSW 13 24,006,377 (GRCm39) missense probably benign
R6311:Slc34a1 UTSW 13 23,999,005 (GRCm39) missense probably benign 0.40
R6323:Slc34a1 UTSW 13 23,998,969 (GRCm39) missense probably benign 0.00
R6476:Slc34a1 UTSW 13 23,996,569 (GRCm39) missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55,550,495 (GRCm39) missense probably benign 0.15
R6814:Slc34a1 UTSW 13 24,006,372 (GRCm39) missense possibly damaging 0.55
R7155:Slc34a1 UTSW 13 24,006,390 (GRCm39) missense probably benign 0.21
R7158:Slc34a1 UTSW 13 55,549,044 (GRCm39) missense probably damaging 0.99
R7188:Slc34a1 UTSW 13 24,006,348 (GRCm39) missense probably damaging 1.00
R7288:Slc34a1 UTSW 13 24,003,095 (GRCm39) missense probably benign 0.09
R7384:Slc34a1 UTSW 13 55,550,747 (GRCm39) missense probably benign 0.00
R7462:Slc34a1 UTSW 13 24,006,401 (GRCm39) missense probably damaging 1.00
R7694:Slc34a1 UTSW 13 55,561,221 (GRCm39) missense probably benign 0.22
R7937:Slc34a1 UTSW 13 23,996,648 (GRCm39) missense probably benign
R8444:Slc34a1 UTSW 13 24,003,061 (GRCm39) missense probably benign 0.00
R8447:Slc34a1 UTSW 13 24,006,309 (GRCm39) missense possibly damaging 0.50
R8932:Slc34a1 UTSW 13 24,004,184 (GRCm39) missense probably benign 0.00
R8977:Slc34a1 UTSW 13 55,556,815 (GRCm39) missense probably benign 0.01
R9635:Slc34a1 UTSW 13 55,556,940 (GRCm39) missense probably damaging 1.00
X0022:Slc34a1 UTSW 13 55,550,828 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATCACATCCTCAGTGGCTC -3'
(R):5'- AGCAGTAGTCGCAGTAGTCAC -3'

Sequencing Primer
(F):5'- TCAGTGGCTCAGCAGGTACTC -3'
(R):5'- GTAGTCGCAGTAGTCACGTAACC -3'
Posted On 2019-11-26