Incidental Mutation 'R7808:Parp4'
ID600966
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7808 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56635748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1150 (S1150A)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161553
AA Change: S1150A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: S1150A

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7854:Parp4 UTSW 14 56659348 missense unknown
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTGAGTTCAAGGCCAG -3'
(R):5'- CTTTGATCCTAGCACTCAGGAAG -3'

Sequencing Primer
(F):5'- AGCCTGGTCTACATAGCAAGTTCTG -3'
(R):5'- GGTCTCTACCAAGGCCAGAAG -3'
Posted On2019-11-26