Incidental Mutation 'R7808:Parp4'
ID 600966
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R7808 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56575619-56659794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 56635748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1150 (S1150A)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect possibly damaging
Transcript: ENSMUST00000161553
AA Change: S1150A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: S1150A

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
poisonous UTSW 14 56635748 missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56613667 missense probably damaging 1.00
toxic UTSW 14 56629158 missense probably benign 0.28
venomous UTSW 14 56589898 missense possibly damaging 0.92
virulent UTSW 14 56587778 missense probably damaging 0.97
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7854:Parp4 UTSW 14 56659348 missense unknown
R7960:Parp4 UTSW 14 56595251 splice site probably null
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
R8344:Parp4 UTSW 14 56648729 missense unknown
R8416:Parp4 UTSW 14 56587814 critical splice donor site probably null
R8726:Parp4 UTSW 14 56629099 missense probably benign 0.04
R8752:Parp4 UTSW 14 56648616 missense unknown
R8804:Parp4 UTSW 14 56616443 nonsense probably null
R9046:Parp4 UTSW 14 56627470 missense probably damaging 0.98
R9176:Parp4 UTSW 14 56635817 missense possibly damaging 0.54
R9303:Parp4 UTSW 14 56595333 frame shift probably null
R9303:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9305:Parp4 UTSW 14 56595333 frame shift probably null
R9305:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9360:Parp4 UTSW 14 56641318 critical splice donor site probably null
R9430:Parp4 UTSW 14 56629216 missense probably damaging 1.00
R9491:Parp4 UTSW 14 56595371 missense probably damaging 0.99
R9729:Parp4 UTSW 14 56648431 missense unknown
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTGAGTTCAAGGCCAG -3'
(R):5'- CTTTGATCCTAGCACTCAGGAAG -3'

Sequencing Primer
(F):5'- AGCCTGGTCTACATAGCAAGTTCTG -3'
(R):5'- GGTCTCTACCAAGGCCAGAAG -3'
Posted On 2019-11-26