Incidental Mutation 'R7808:Tfcp2'
ID600971
Institutional Source Beutler Lab
Gene Symbol Tfcp2
Ensembl Gene ENSMUSG00000009733
Gene Nametranscription factor CP2
SynonymsTcfcp2, CP-2, D230015P20Rik, LBP1, UBP-1, CP2, LSF, LBP-1c, LBP-1d
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7808 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location100498012-100552008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100522429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 175 (F175S)
Ref Sequence ENSEMBL: ENSMUSP00000009877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009877] [ENSMUST00000229265] [ENSMUST00000229581] [ENSMUST00000229696]
Predicted Effect probably damaging
Transcript: ENSMUST00000009877
AA Change: F175S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009877
Gene: ENSMUSG00000009733
AA Change: F175S

DomainStartEndE-ValueType
Pfam:CP2 44 260 8.6e-60 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229265
Predicted Effect probably damaging
Transcript: ENSMUST00000229581
AA Change: F175S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229696
AA Change: F175S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no apparent alterations in overall behavior, hematopoiesis, globin chain synthesis, or immunological function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Adgb A G 10: 10,378,659 probably null Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Parp4 T G 14: 56,635,748 S1150A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Tfcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Tfcp2 APN 15 100513178 unclassified probably benign
IGL00916:Tfcp2 APN 15 100520678 missense probably damaging 1.00
IGL01819:Tfcp2 APN 15 100504439 missense probably benign 0.02
IGL02075:Tfcp2 APN 15 100513180 unclassified probably benign
IGL02370:Tfcp2 APN 15 100512304 missense probably damaging 1.00
IGL02608:Tfcp2 APN 15 100514110 missense possibly damaging 0.48
IGL03001:Tfcp2 APN 15 100528421 missense possibly damaging 0.47
R0153:Tfcp2 UTSW 15 100514827 missense probably damaging 1.00
R2879:Tfcp2 UTSW 15 100551320 splice site probably null
R3103:Tfcp2 UTSW 15 100525600 missense probably damaging 1.00
R4302:Tfcp2 UTSW 15 100514849 missense possibly damaging 0.77
R4929:Tfcp2 UTSW 15 100528489 missense probably benign 0.29
R4965:Tfcp2 UTSW 15 100525650 missense probably damaging 1.00
R5196:Tfcp2 UTSW 15 100520714 missense probably damaging 1.00
R5407:Tfcp2 UTSW 15 100527874 splice site probably null
R6091:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R6136:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R7241:Tfcp2 UTSW 15 100518587 missense possibly damaging 0.95
R8204:Tfcp2 UTSW 15 100522448 missense possibly damaging 0.68
R8841:Tfcp2 UTSW 15 100513108 missense probably damaging 1.00
R8931:Tfcp2 UTSW 15 100504417 missense possibly damaging 0.58
X0011:Tfcp2 UTSW 15 100513080 critical splice donor site probably null
X0040:Tfcp2 UTSW 15 100518598 missense probably damaging 1.00
X0063:Tfcp2 UTSW 15 100512301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTGAACAGACCATGTG -3'
(R):5'- CATCACAAACGGTTGCTTTCTTAC -3'

Sequencing Primer
(F):5'- CCTTGAACAGACCATGTGACTGTG -3'
(R):5'- CACGATCATGGTGGCACATGTTC -3'
Posted On2019-11-26