Incidental Mutation 'R7809:Spata21'
ID601000
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Namespermatogenesis associated 21
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141088333-141112760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141104043 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 434 (A434T)
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
Predicted Effect probably null
Transcript: ENSMUST00000051907
AA Change: A434T

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004
AA Change: A434T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Cnot1 A T 8: 95,751,778 I973N probably damaging Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cttnbp2 C A 6: 18,434,290 R523L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Polr3e A G 7: 120,924,226 D14G probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sall3 T A 18: 80,974,360 T118S probably benign Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Tdrd9 G A 12: 112,032,721 G757R probably damaging Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141111364 unclassified probably null
IGL02679:Spata21 APN 4 141111265 unclassified probably benign
R1772:Spata21 UTSW 4 141111296 missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141111381 missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141111405 missense probably damaging 0.99
R2015:Spata21 UTSW 4 141107329 nonsense probably null
R2093:Spata21 UTSW 4 141096966 missense probably benign 0.04
R2911:Spata21 UTSW 4 141103082 missense possibly damaging 0.46
R4809:Spata21 UTSW 4 141097120 critical splice donor site probably null
R4897:Spata21 UTSW 4 141104950 missense probably damaging 0.99
R4907:Spata21 UTSW 4 141097121 critical splice donor site probably null
R4921:Spata21 UTSW 4 141112091 missense probably damaging 1.00
R5269:Spata21 UTSW 4 141103021 missense probably damaging 1.00
R5380:Spata21 UTSW 4 141107185 missense probably damaging 1.00
R5602:Spata21 UTSW 4 141096899 missense probably benign
R6982:Spata21 UTSW 4 141096873 missense possibly damaging 0.71
R7503:Spata21 UTSW 4 141095303 missense probably benign 0.05
R8072:Spata21 UTSW 4 141112006 nonsense probably null
Z1177:Spata21 UTSW 4 141098002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGACACGACAGAGTCC -3'
(R):5'- TGGGGCCAAATGCAGTTGAC -3'

Sequencing Primer
(F):5'- GGAAGTTTCCCTAACCTCTGCTG -3'
(R):5'- AAATGCAGTTGACCCCCTGGAG -3'
Posted On2019-11-26