Incidental Mutation 'R7809:Cttnbp2'
ID601006
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18434290 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 523 (R523L)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000148602]
Predicted Effect probably damaging
Transcript: ENSMUST00000090601
AA Change: R523L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: R523L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129669
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: R54L

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148602
AA Change: R523L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: R523L

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Cnot1 A T 8: 95,751,778 I973N probably damaging Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Polr3e A G 7: 120,924,226 D14G probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sall3 T A 18: 80,974,360 T118S probably benign Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Spata21 G A 4: 141,104,043 A434T probably null Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Tdrd9 G A 12: 112,032,721 G757R probably damaging Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
BB009:Cttnbp2 UTSW 6 18427533 missense probably damaging 1.00
BB019:Cttnbp2 UTSW 6 18427533 missense probably damaging 1.00
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
R7353:Cttnbp2 UTSW 6 18375944 missense possibly damaging 0.94
R7465:Cttnbp2 UTSW 6 18501992 missense probably damaging 1.00
R7500:Cttnbp2 UTSW 6 18378420 missense probably benign 0.00
R7534:Cttnbp2 UTSW 6 18420765 critical splice donor site probably null
R7646:Cttnbp2 UTSW 6 18375940 missense probably damaging 1.00
R7678:Cttnbp2 UTSW 6 18382810 missense probably damaging 1.00
R7816:Cttnbp2 UTSW 6 18448414 missense probably damaging 1.00
R7817:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R7932:Cttnbp2 UTSW 6 18427533 missense probably damaging 1.00
R8010:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8011:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8014:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8015:Cttnbp2 UTSW 6 18426093 missense possibly damaging 0.58
R8095:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
Z1176:Cttnbp2 UTSW 6 18408709 missense probably benign 0.00
Z1176:Cttnbp2 UTSW 6 18408725 missense possibly damaging 0.94
Z1176:Cttnbp2 UTSW 6 18420836 missense possibly damaging 0.83
Z1176:Cttnbp2 UTSW 6 18501960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCTTGTGGCAAAGTAGAGG -3'
(R):5'- GGGCAATGCAAATGACCCAG -3'

Sequencing Primer
(F):5'- GGAGGTGAAGCCACAATTTTGTTATC -3'
(R):5'- AATGACCCAGACCAGAATGG -3'
Posted On2019-11-26