Incidental Mutation 'R7809:Polr3e'
ID601014
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Namepolymerase (RNA) III (DNA directed) polypeptide E
SynonymsSin, RPC5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120917744-120947432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120924226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 14 (D14G)
Ref Sequence ENSEMBL: ENSMUSP00000033173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
Predicted Effect probably damaging
Transcript: ENSMUST00000033173
AA Change: D14G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: D14G

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106483
AA Change: D14G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: D14G

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207481
AA Change: D14G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Cnot1 A T 8: 95,751,778 I973N probably damaging Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cttnbp2 C A 6: 18,434,290 R523L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sall3 T A 18: 80,974,360 T118S probably benign Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Spata21 G A 4: 141,104,043 A434T probably null Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Tdrd9 G A 12: 112,032,721 G757R probably damaging Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120940811 nonsense probably null
IGL01664:Polr3e APN 7 120931317 splice site probably benign
IGL01980:Polr3e APN 7 120940296 splice site probably benign
IGL02027:Polr3e APN 7 120930963 missense probably damaging 1.00
IGL02208:Polr3e APN 7 120932140 missense probably damaging 0.99
IGL02549:Polr3e APN 7 120939759 missense probably damaging 1.00
IGL03338:Polr3e APN 7 120937620 missense probably benign 0.06
R1192:Polr3e UTSW 7 120933308 missense probably benign 0.03
R1328:Polr3e UTSW 7 120933823 splice site probably benign
R1435:Polr3e UTSW 7 120940788 missense probably benign 0.16
R1528:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R1754:Polr3e UTSW 7 120939298 critical splice donor site probably null
R1924:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R2169:Polr3e UTSW 7 120932137 missense probably damaging 1.00
R2201:Polr3e UTSW 7 120932242 missense probably benign
R2362:Polr3e UTSW 7 120942564 missense probably damaging 1.00
R2696:Polr3e UTSW 7 120933377 missense probably damaging 1.00
R4416:Polr3e UTSW 7 120939057 critical splice donor site probably null
R5278:Polr3e UTSW 7 120922961 missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120922949 missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120940689 missense possibly damaging 0.82
R5790:Polr3e UTSW 7 120927967 missense probably damaging 1.00
R6242:Polr3e UTSW 7 120940467 missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120927982 missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120927999 missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120944650 missense probably damaging 0.98
R7110:Polr3e UTSW 7 120940287 splice site probably null
R7771:Polr3e UTSW 7 120940578 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAGCTCAAGCATGGGTG -3'
(R):5'- AATCTGCATCCCACATGTCCTG -3'

Sequencing Primer
(F):5'- GGTGCTCCTTCCAGGTAGAATAAC -3'
(R):5'- GCTTGCCCATTTGAGCAAG -3'
Posted On2019-11-26