Incidental Mutation 'R7809:Cnot1'
ID601019
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95751778 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 973 (I973N)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: I973N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I973N

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: I978N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I978N

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211887
AA Change: I971N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000213006
AA Change: I978N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cttnbp2 C A 6: 18,434,290 R523L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Polr3e A G 7: 120,924,226 D14G probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sall3 T A 18: 80,974,360 T118S probably benign Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Spata21 G A 4: 141,104,043 A434T probably null Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Tdrd9 G A 12: 112,032,721 G757R probably damaging Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7940:Cnot1 UTSW 8 95745647 frame shift probably null
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CACAAAGTGTACTCTGACCTCC -3'
(R):5'- GGCTGGTAGTCTTCCATTTGAC -3'

Sequencing Primer
(F):5'- AAGTGTACTCTGACCTCCGTACAG -3'
(R):5'- CCATTTGACATTCTCTTCAAAGTAAC -3'
Posted On2019-11-26