Incidental Mutation 'R7809:Tdrd9'
ID601033
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112032721 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 757 (G757R)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: G757R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: G757R

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Cnot1 A T 8: 95,751,778 I973N probably damaging Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cttnbp2 C A 6: 18,434,290 R523L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Polr3e A G 7: 120,924,226 D14G probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sall3 T A 18: 80,974,360 T118S probably benign Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Spata21 G A 4: 141,104,043 A434T probably null Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 splice site probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
R7751:Tdrd9 UTSW 12 111992548 missense probably benign 0.09
R7844:Tdrd9 UTSW 12 111997952 missense possibly damaging 0.63
R7854:Tdrd9 UTSW 12 112046961 missense probably benign 0.00
R7903:Tdrd9 UTSW 12 112051976 missense possibly damaging 0.95
R7938:Tdrd9 UTSW 12 112031215 missense possibly damaging 0.86
R8018:Tdrd9 UTSW 12 112032746 missense probably benign 0.12
R8018:Tdrd9 UTSW 12 112044388 missense probably damaging 0.99
R8090:Tdrd9 UTSW 12 112015935 missense probably damaging 1.00
R8157:Tdrd9 UTSW 12 111985066 missense probably benign 0.44
R8198:Tdrd9 UTSW 12 112040429 missense probably damaging 1.00
R8203:Tdrd9 UTSW 12 112025630 missense probably damaging 1.00
R8512:Tdrd9 UTSW 12 112046193 missense probably benign
R8721:Tdrd9 UTSW 12 112036455 missense probably damaging 1.00
R8889:Tdrd9 UTSW 12 112013284 missense probably benign 0.07
R8892:Tdrd9 UTSW 12 112013284 missense probably benign 0.07
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Z1177:Tdrd9 UTSW 12 111971654 missense probably benign 0.08
Z1177:Tdrd9 UTSW 12 111993891 missense probably damaging 0.96
Z1177:Tdrd9 UTSW 12 112015921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTGTCCACATTGGCTC -3'
(R):5'- TTGTTGGAGCACTGATAGCCC -3'

Sequencing Primer
(F):5'- CGCAGAAGCATTGTAGCTATTCTG -3'
(R):5'- AGCACTGATAGCCCTCTGTG -3'
Posted On2019-11-26