Incidental Mutation 'R7809:Sall3'
ID601047
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7809 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80974360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 118 (T118S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: T118S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: T118S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,846,990 S110P probably damaging Het
Acot13 G A 13: 24,820,796 T62I probably damaging Het
Adam33 C G 2: 131,051,346 R779P probably benign Het
Adgrv1 G A 13: 81,528,641 P2024S possibly damaging Het
Afm A G 5: 90,524,816 N170S probably damaging Het
Ambn G A 5: 88,467,824 V371I probably benign Het
Apbb1 G A 7: 105,573,807 P199L probably benign Het
Axdnd1 A T 1: 156,392,801 C118* probably null Het
Carf G T 1: 60,144,067 V443L probably damaging Het
Ckap5 G A 2: 91,606,357 A1601T probably benign Het
Cnot1 A T 8: 95,751,778 I973N probably damaging Het
Col11a1 A G 3: 114,097,186 T391A unknown Het
Cracr2a A T 6: 127,649,962 M569L probably benign Het
Cspg4 T C 9: 56,890,190 F1313L probably damaging Het
Cttnbp2 C A 6: 18,434,290 R523L probably damaging Het
Cxadr T C 16: 78,333,519 probably null Het
Dnah17 A T 11: 118,104,636 M962K probably benign Het
Dnm1 T C 2: 32,353,079 K44R probably damaging Het
Fam71b A G 11: 46,407,804 E645G Het
Fat3 T C 9: 16,006,628 S1500G probably damaging Het
Gad1 T C 2: 70,597,259 F503S possibly damaging Het
Gm20730 T C 6: 43,082,055 I15V probably benign Het
Gmppb T G 9: 108,051,455 *361G probably null Het
Inpp5f T C 7: 128,667,643 V239A probably damaging Het
Irf4 A T 13: 30,757,432 Y257F probably benign Het
Kcnma1 T C 14: 23,373,256 D793G probably benign Het
Kif11 T C 19: 37,384,609 V92A probably damaging Het
Lrriq1 T C 10: 103,215,817 K358R probably damaging Het
Mcpt4 T A 14: 56,060,684 I137F possibly damaging Het
Muc6 T A 7: 141,640,371 H1358L probably benign Het
Mug1 A T 6: 121,878,985 M979L possibly damaging Het
Mvb12a C A 8: 71,545,662 P175T probably benign Het
Myh13 A G 11: 67,350,341 E848G probably benign Het
Olfr1202 A T 2: 88,817,558 H129L probably damaging Het
Oxnad1 T C 14: 32,101,005 V231A probably benign Het
Pcdhac1 A G 18: 37,090,956 N274S possibly damaging Het
Plxnc1 T A 10: 94,794,440 K1532N probably damaging Het
Polr3e A G 7: 120,924,226 D14G probably damaging Het
Prex1 A G 2: 166,573,244 F1432S possibly damaging Het
Prlhr A G 19: 60,467,855 L91P probably damaging Het
Prom1 C T 5: 44,020,867 V508I probably benign Het
Rmnd1 T C 10: 4,407,848 Y387C probably damaging Het
Sf3b1 A T 1: 54,995,455 D1015E possibly damaging Het
Sfmbt2 A G 2: 10,393,344 N12S probably benign Het
Sohlh1 A C 2: 25,845,277 S198A probably benign Het
Sorbs2 T C 8: 45,745,428 S38P possibly damaging Het
Spata21 G A 4: 141,104,043 A434T probably null Het
Stard13 T A 5: 151,190,024 Q24L probably damaging Het
Syne2 G T 12: 75,967,456 M3140I probably benign Het
Tango6 T C 8: 106,689,294 probably null Het
Tdrd9 G A 12: 112,032,721 G757R probably damaging Het
Thada A C 17: 84,451,837 V198G possibly damaging Het
Tmf1 T C 6: 97,161,459 N833D probably damaging Het
Trav7-3 T C 14: 53,443,615 M38T probably benign Het
Ttc38 A C 15: 85,838,738 Q129P possibly damaging Het
Uox A T 3: 146,627,858 K271* probably null Het
Urgcp A T 11: 5,723,133 D47E probably benign Het
Usp17lb A G 7: 104,841,213 I169T probably damaging Het
Wdr66 A G 5: 123,264,831 D459G probably damaging Het
Wdr75 T C 1: 45,823,436 I805T probably benign Het
Zfp131 A G 13: 119,788,910 F59S probably damaging Het
Zfp383 G A 7: 29,910,236 A21T possibly damaging Het
Zfp810 T C 9: 22,278,982 Y210C possibly damaging Het
Zfp871 A G 17: 32,774,852 C450R probably damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCACCCTGTGAGAACTGTG -3'
(R):5'- GTGCAGAGTTCTTCAAGTGGGC -3'

Sequencing Primer
(F):5'- TGTGAGAACTGTGCCACG -3'
(R):5'- TCTTCAAGTGGGCGGACTTCC -3'
Posted On2019-11-26