Incidental Mutation 'R7810:Slc19a3'
ID601051
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7810 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83019441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 349 (V349I)
Ref Sequence ENSEMBL: ENSMUSP00000041683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
AA Change: V349I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: V349I

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
AA Change: V349I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: V349I

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,677,304 Y93* probably null Het
Adam34 T C 8: 43,652,008 E200G probably benign Het
Ankfy1 C T 11: 72,754,455 Q787* probably null Het
BC003331 T C 1: 150,392,908 probably benign Het
Birc6 T A 17: 74,548,820 H208Q probably damaging Het
Brsk2 T A 7: 141,985,420 probably null Het
Cabp5 T A 7: 13,398,338 F11I possibly damaging Het
Casc1 T G 6: 145,194,586 D163A probably benign Het
Ccdc88a T C 11: 29,485,964 Y1296H probably damaging Het
Ccdc88b A G 19: 6,849,086 V1087A probably benign Het
Cct3 C T 3: 88,321,135 T508I probably damaging Het
Ceacam9 T A 7: 16,723,733 M57K possibly damaging Het
Ces1f T C 8: 93,256,918 E487G probably damaging Het
Chd5 A G 4: 152,358,575 K278E probably damaging Het
Cntnap3 T A 13: 64,793,308 H286L possibly damaging Het
Efr3a G T 15: 65,787,173 probably benign Het
Fam208b T C 13: 3,575,714 K1412R possibly damaging Het
Fastkd2 T A 1: 63,731,692 I69N possibly damaging Het
Flg2 T C 3: 93,200,241 I11T possibly damaging Het
Folr2 T C 7: 101,840,895 M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 F360S probably damaging Het
Galr2 T C 11: 116,283,120 V192A probably benign Het
Gas6 A T 8: 13,466,809 I563N probably damaging Het
Gbe1 T C 16: 70,527,197 F567L possibly damaging Het
Gm12695 G A 4: 96,731,371 H423Y probably damaging Het
Gm14548 C A 7: 3,894,205 C544F probably damaging Het
Gm6902 T C 7: 23,273,818 T95A probably benign Het
Gpr155 G T 2: 73,381,952 A109D probably damaging Het
Hsdl1 T C 8: 119,567,972 D5G probably damaging Het
Hyal1 C T 9: 107,578,429 P313S probably damaging Het
Igfn1 G A 1: 135,974,789 T390M probably damaging Het
Irx1 C A 13: 71,959,798 R255L probably benign Het
Itga2 T A 13: 114,866,179 T592S probably benign Het
Kit C A 5: 75,609,322 S131R probably benign Het
Map1b T C 13: 99,431,882 T1444A unknown Het
Mapk8ip1 C T 2: 92,389,151 E112K probably benign Het
Marveld3 T C 8: 109,954,634 I210V probably damaging Het
Masp1 T A 16: 23,476,318 I398L probably benign Het
Mmrn1 T C 6: 60,976,325 I530T probably benign Het
Mtss1l A G 8: 110,726,201 Y26C probably damaging Het
Myo5a T A 9: 75,160,465 S600R probably benign Het
Myo5a A G 9: 75,169,010 I836V probably benign Het
Naaladl1 A G 19: 6,109,664 D375G probably damaging Het
Napepld T A 5: 21,683,265 D62V possibly damaging Het
Nedd9 A C 13: 41,312,007 I719S possibly damaging Het
Nes T A 3: 87,975,616 M394K probably benign Het
Nlrc5 A T 8: 94,505,144 Y1288F possibly damaging Het
Nlrp14 T A 7: 107,192,575 C822* probably null Het
Noa1 A C 5: 77,309,224 L278R probably damaging Het
Nop16 A G 13: 54,590,076 probably benign Het
Olfr1448 A G 19: 12,919,865 V148A probably benign Het
Olfr746 A T 14: 50,653,993 Y252F probably benign Het
Osbpl10 C T 9: 115,061,894 H117Y probably benign Het
Oxct1 A T 15: 4,047,576 E130D probably benign Het
Padi2 A G 4: 140,949,264 E571G possibly damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Pdcd11 G A 19: 47,098,220 E222K possibly damaging Het
Plekha2 A G 8: 25,088,340 probably null Het
Pogz T C 3: 94,870,107 L366P probably benign Het
Ppp4r3b A G 11: 29,188,086 I145V probably benign Het
Prkcd A G 14: 30,598,450 probably null Het
Ptprk T A 10: 28,592,857 H1438Q probably damaging Het
Rbm4 A T 19: 4,792,622 V63E possibly damaging Het
Sbk2 T A 7: 4,958,939 H116L probably damaging Het
Sdk1 A G 5: 141,937,679 T352A probably benign Het
Sept9 T A 11: 117,359,438 C529* probably null Het
Setx T A 2: 29,148,651 V1716D probably benign Het
Slc27a4 C A 2: 29,805,710 R86S probably benign Het
Slc4a8 A G 15: 100,798,178 H613R possibly damaging Het
Smoc2 A G 17: 14,325,622 R58G probably damaging Het
Sphkap T A 1: 83,276,300 N1243Y probably damaging Het
Srsf5 T C 12: 80,949,946 S261P unknown Het
Tab1 A T 15: 80,158,798 T398S possibly damaging Het
Tas2r131 T A 6: 132,957,742 T35S probably benign Het
Tigd4 T A 3: 84,595,003 V409E possibly damaging Het
Tlr12 T C 4: 128,616,708 Q583R probably benign Het
Tmprss9 T A 10: 80,897,311 C894S unknown Het
Topaz1 T A 9: 122,749,185 S387T probably benign Het
Tsfm T C 10: 127,011,689 R178G probably benign Het
Ttll13 T C 7: 80,253,127 I181T probably damaging Het
Ttyh3 T A 5: 140,625,141 K97N Het
Ubr4 A G 4: 139,415,083 E38G Het
Ugt2b37 T C 5: 87,254,259 Y171C probably damaging Het
Unc5b C A 10: 60,765,241 M935I probably benign Het
Usp34 T C 11: 23,412,314 S1606P Het
Vmn1r195 T C 13: 22,279,074 L238P probably damaging Het
Vmn2r85 T A 10: 130,425,212 M419L probably benign Het
Washc2 G T 6: 116,259,059 A1164S probably benign Het
Wdfy3 A T 5: 101,895,074 M1937K probably benign Het
Wdfy3 A T 5: 101,951,399 L261* probably null Het
Wdr64 A T 1: 175,731,526 Y285F probably benign Het
Wtap A G 17: 12,980,910 L62P probably damaging Het
Zfp94 C A 7: 24,303,073 V315F probably benign Het
Zhx1 A T 15: 58,048,402 probably null Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R8150:Slc19a3 UTSW 1 83022495 missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATGGCTTCACTGAATTCCATTC -3'
(R):5'- CGTCTTGAAATCTGAGTTCTGTC -3'

Sequencing Primer
(F):5'- CACTGCAATGGACTAAAATCCTTCTG -3'
(R):5'- AAATCTGAGTTCTGTCTGTTTGC -3'
Posted On2019-11-26