Incidental Mutation 'R7810:Flg2'
ID 601063
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 045865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7810 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93107548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 11 (I11T)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000098884
AA Change: I11T

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: I11T

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 44,105,045 (GRCm39) E200G probably benign Het
Ankfy1 C T 11: 72,645,281 (GRCm39) Q787* probably null Het
Birc6 T A 17: 74,855,815 (GRCm39) H208Q probably damaging Het
Brsk2 T A 7: 141,539,157 (GRCm39) probably null Het
Cabp5 T A 7: 13,132,263 (GRCm39) F11I possibly damaging Het
Ccdc88a T C 11: 29,435,964 (GRCm39) Y1296H probably damaging Het
Ccdc88b A G 19: 6,826,454 (GRCm39) V1087A probably benign Het
Cct3 C T 3: 88,228,442 (GRCm39) T508I probably damaging Het
Ceacam9 T A 7: 16,457,658 (GRCm39) M57K possibly damaging Het
Ces1f T C 8: 93,983,546 (GRCm39) E487G probably damaging Het
Chd5 A G 4: 152,443,032 (GRCm39) K278E probably damaging Het
Cntnap3 T A 13: 64,941,122 (GRCm39) H286L possibly damaging Het
Dnai7 T G 6: 145,140,312 (GRCm39) D163A probably benign Het
Efr3a G T 15: 65,659,022 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,770,851 (GRCm39) I69N possibly damaging Het
Folr2 T C 7: 101,490,102 (GRCm39) M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 (GRCm39) F360S probably damaging Het
Galr2 T C 11: 116,173,946 (GRCm39) V192A probably benign Het
Gas6 A T 8: 13,516,809 (GRCm39) I563N probably damaging Het
Gbe1 T C 16: 70,324,085 (GRCm39) F567L possibly damaging Het
Gm12695 G A 4: 96,619,608 (GRCm39) H423Y probably damaging Het
Gm6902 T C 7: 22,973,243 (GRCm39) T95A probably benign Het
Gpr155 G T 2: 73,212,296 (GRCm39) A109D probably damaging Het
Hsdl1 T C 8: 120,294,711 (GRCm39) D5G probably damaging Het
Hyal1 C T 9: 107,455,628 (GRCm39) P313S probably damaging Het
Igfn1 G A 1: 135,902,527 (GRCm39) T390M probably damaging Het
Irx1 C A 13: 72,107,917 (GRCm39) R255L probably benign Het
Itga2 T A 13: 115,002,715 (GRCm39) T592S probably benign Het
Kit C A 5: 75,769,982 (GRCm39) S131R probably benign Het
Map1b T C 13: 99,568,390 (GRCm39) T1444A unknown Het
Mapk8ip1 C T 2: 92,219,496 (GRCm39) E112K probably benign Het
Marveld3 T C 8: 110,681,266 (GRCm39) I210V probably damaging Het
Masp1 T A 16: 23,295,068 (GRCm39) I398L probably benign Het
Mmrn1 T C 6: 60,953,309 (GRCm39) I530T probably benign Het
Mtss2 A G 8: 111,452,833 (GRCm39) Y26C probably damaging Het
Myo5a T A 9: 75,067,747 (GRCm39) S600R probably benign Het
Myo5a A G 9: 75,076,292 (GRCm39) I836V probably benign Het
Naaladl1 A G 19: 6,159,694 (GRCm39) D375G probably damaging Het
Napepld T A 5: 21,888,263 (GRCm39) D62V possibly damaging Het
Nedd9 A C 13: 41,465,483 (GRCm39) I719S possibly damaging Het
Nes T A 3: 87,882,923 (GRCm39) M394K probably benign Het
Nlrc5 A T 8: 95,231,772 (GRCm39) Y1288F possibly damaging Het
Nlrp14 T A 7: 106,791,782 (GRCm39) C822* probably null Het
Noa1 A C 5: 77,457,071 (GRCm39) L278R probably damaging Het
Nop16 A G 13: 54,737,889 (GRCm39) probably benign Het
Odr4 T C 1: 150,268,659 (GRCm39) probably benign Het
Or11h7 A T 14: 50,891,450 (GRCm39) Y252F probably benign Het
Or5b12 A G 19: 12,897,229 (GRCm39) V148A probably benign Het
Osbpl10 C T 9: 114,890,962 (GRCm39) H117Y probably benign Het
Oxct1 A T 15: 4,077,058 (GRCm39) E130D probably benign Het
Padi2 A G 4: 140,676,575 (GRCm39) E571G possibly damaging Het
Pcdhac2 G A 18: 37,278,717 (GRCm39) V566M probably benign Het
Pdcd11 G A 19: 47,086,659 (GRCm39) E222K possibly damaging Het
Pira12 C A 7: 3,897,204 (GRCm39) C544F probably damaging Het
Plekha2 A G 8: 25,578,356 (GRCm39) probably null Het
Pogz T C 3: 94,777,418 (GRCm39) L366P probably benign Het
Ppp4r3b A G 11: 29,138,086 (GRCm39) I145V probably benign Het
Prkcd A G 14: 30,320,407 (GRCm39) probably null Het
Ptprk T A 10: 28,468,853 (GRCm39) H1438Q probably damaging Het
Rbm4 A T 19: 4,842,650 (GRCm39) V63E possibly damaging Het
Sbk2 T A 7: 4,961,938 (GRCm39) H116L probably damaging Het
Sdk1 A G 5: 141,923,434 (GRCm39) T352A probably benign Het
Septin9 T A 11: 117,250,264 (GRCm39) C529* probably null Het
Setx T A 2: 29,038,663 (GRCm39) V1716D probably benign Het
Slc19a3 C T 1: 82,997,162 (GRCm39) V349I probably benign Het
Slc27a4 C A 2: 29,695,722 (GRCm39) R86S probably benign Het
Slc4a8 A G 15: 100,696,059 (GRCm39) H613R possibly damaging Het
Smoc2 A G 17: 14,545,884 (GRCm39) R58G probably damaging Het
Sphkap T A 1: 83,254,021 (GRCm39) N1243Y probably damaging Het
Srsf5 T C 12: 80,996,720 (GRCm39) S261P unknown Het
Tab1 A T 15: 80,042,999 (GRCm39) T398S possibly damaging Het
Tas2r131 T A 6: 132,934,705 (GRCm39) T35S probably benign Het
Tasor2 T C 13: 3,625,714 (GRCm39) K1412R possibly damaging Het
Tigd4 T A 3: 84,502,310 (GRCm39) V409E possibly damaging Het
Tlr12 T C 4: 128,510,501 (GRCm39) Q583R probably benign Het
Tmprss9 T A 10: 80,733,145 (GRCm39) C894S unknown Het
Topaz1 T A 9: 122,578,250 (GRCm39) S387T probably benign Het
Tsfm T C 10: 126,847,558 (GRCm39) R178G probably benign Het
Ttll13 T C 7: 79,902,875 (GRCm39) I181T probably damaging Het
Ttyh3 T A 5: 140,610,896 (GRCm39) K97N Het
Ubr4 A G 4: 139,142,394 (GRCm39) E38G Het
Ugt2b37 T C 5: 87,402,118 (GRCm39) Y171C probably damaging Het
Unc5b C A 10: 60,601,020 (GRCm39) M935I probably benign Het
Usp34 T C 11: 23,362,314 (GRCm39) S1606P Het
Vmn1r195 T C 13: 22,463,244 (GRCm39) L238P probably damaging Het
Vmn2r85 T A 10: 130,261,081 (GRCm39) M419L probably benign Het
Washc2 G T 6: 116,236,020 (GRCm39) A1164S probably benign Het
Wdfy3 A T 5: 102,042,940 (GRCm39) M1937K probably benign Het
Wdfy3 A T 5: 102,099,265 (GRCm39) L261* probably null Het
Wdr64 A T 1: 175,559,092 (GRCm39) Y285F probably benign Het
Wtap A G 17: 13,199,797 (GRCm39) L62P probably damaging Het
Zfp1007 A C 5: 109,825,170 (GRCm39) Y93* probably null Het
Zfp94 C A 7: 24,002,498 (GRCm39) V315F probably benign Het
Zhx1 A T 15: 57,911,798 (GRCm39) probably null Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCATACTTGTATGTTGAGGTAG -3'
(R):5'- AGTGCATGTTCCAACTAATCTGAG -3'

Sequencing Primer
(F):5'- GTGGTCCAACAATGCTGTCACAG -3'
(R):5'- CAGCAGTTCCTTTAGCTCA -3'
Posted On 2019-11-26