Incidental Mutation 'R7810:Kit'
ID601072
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7810 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75609322 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 131 (S131R)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: S131R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: S131R

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: S131R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: S131R

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,677,304 Y93* probably null Het
Adam34 T C 8: 43,652,008 E200G probably benign Het
Ankfy1 C T 11: 72,754,455 Q787* probably null Het
BC003331 T C 1: 150,392,908 probably benign Het
Birc6 T A 17: 74,548,820 H208Q probably damaging Het
Brsk2 T A 7: 141,985,420 probably null Het
Cabp5 T A 7: 13,398,338 F11I possibly damaging Het
Casc1 T G 6: 145,194,586 D163A probably benign Het
Ccdc88a T C 11: 29,485,964 Y1296H probably damaging Het
Ccdc88b A G 19: 6,849,086 V1087A probably benign Het
Cct3 C T 3: 88,321,135 T508I probably damaging Het
Ceacam9 T A 7: 16,723,733 M57K possibly damaging Het
Ces1f T C 8: 93,256,918 E487G probably damaging Het
Chd5 A G 4: 152,358,575 K278E probably damaging Het
Cntnap3 T A 13: 64,793,308 H286L possibly damaging Het
Efr3a G T 15: 65,787,173 probably benign Het
Fam208b T C 13: 3,575,714 K1412R possibly damaging Het
Fastkd2 T A 1: 63,731,692 I69N possibly damaging Het
Flg2 T C 3: 93,200,241 I11T possibly damaging Het
Folr2 T C 7: 101,840,895 M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 F360S probably damaging Het
Galr2 T C 11: 116,283,120 V192A probably benign Het
Gas6 A T 8: 13,466,809 I563N probably damaging Het
Gbe1 T C 16: 70,527,197 F567L possibly damaging Het
Gm12695 G A 4: 96,731,371 H423Y probably damaging Het
Gm14548 C A 7: 3,894,205 C544F probably damaging Het
Gm6902 T C 7: 23,273,818 T95A probably benign Het
Gpr155 G T 2: 73,381,952 A109D probably damaging Het
Hsdl1 T C 8: 119,567,972 D5G probably damaging Het
Hyal1 C T 9: 107,578,429 P313S probably damaging Het
Igfn1 G A 1: 135,974,789 T390M probably damaging Het
Irx1 C A 13: 71,959,798 R255L probably benign Het
Itga2 T A 13: 114,866,179 T592S probably benign Het
Map1b T C 13: 99,431,882 T1444A unknown Het
Mapk8ip1 C T 2: 92,389,151 E112K probably benign Het
Marveld3 T C 8: 109,954,634 I210V probably damaging Het
Masp1 T A 16: 23,476,318 I398L probably benign Het
Mmrn1 T C 6: 60,976,325 I530T probably benign Het
Mtss1l A G 8: 110,726,201 Y26C probably damaging Het
Myo5a T A 9: 75,160,465 S600R probably benign Het
Myo5a A G 9: 75,169,010 I836V probably benign Het
Naaladl1 A G 19: 6,109,664 D375G probably damaging Het
Napepld T A 5: 21,683,265 D62V possibly damaging Het
Nedd9 A C 13: 41,312,007 I719S possibly damaging Het
Nes T A 3: 87,975,616 M394K probably benign Het
Nlrc5 A T 8: 94,505,144 Y1288F possibly damaging Het
Nlrp14 T A 7: 107,192,575 C822* probably null Het
Noa1 A C 5: 77,309,224 L278R probably damaging Het
Nop16 A G 13: 54,590,076 probably benign Het
Olfr1448 A G 19: 12,919,865 V148A probably benign Het
Olfr746 A T 14: 50,653,993 Y252F probably benign Het
Osbpl10 C T 9: 115,061,894 H117Y probably benign Het
Oxct1 A T 15: 4,047,576 E130D probably benign Het
Padi2 A G 4: 140,949,264 E571G possibly damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Pdcd11 G A 19: 47,098,220 E222K possibly damaging Het
Plekha2 A G 8: 25,088,340 probably null Het
Pogz T C 3: 94,870,107 L366P probably benign Het
Ppp4r3b A G 11: 29,188,086 I145V probably benign Het
Prkcd A G 14: 30,598,450 probably null Het
Ptprk T A 10: 28,592,857 H1438Q probably damaging Het
Rbm4 A T 19: 4,792,622 V63E possibly damaging Het
Sbk2 T A 7: 4,958,939 H116L probably damaging Het
Sdk1 A G 5: 141,937,679 T352A probably benign Het
Sept9 T A 11: 117,359,438 C529* probably null Het
Setx T A 2: 29,148,651 V1716D probably benign Het
Slc19a3 C T 1: 83,019,441 V349I probably benign Het
Slc27a4 C A 2: 29,805,710 R86S probably benign Het
Slc4a8 A G 15: 100,798,178 H613R possibly damaging Het
Smoc2 A G 17: 14,325,622 R58G probably damaging Het
Sphkap T A 1: 83,276,300 N1243Y probably damaging Het
Srsf5 T C 12: 80,949,946 S261P unknown Het
Tab1 A T 15: 80,158,798 T398S possibly damaging Het
Tas2r131 T A 6: 132,957,742 T35S probably benign Het
Tigd4 T A 3: 84,595,003 V409E possibly damaging Het
Tlr12 T C 4: 128,616,708 Q583R probably benign Het
Tmprss9 T A 10: 80,897,311 C894S unknown Het
Topaz1 T A 9: 122,749,185 S387T probably benign Het
Tsfm T C 10: 127,011,689 R178G probably benign Het
Ttll13 T C 7: 80,253,127 I181T probably damaging Het
Ttyh3 T A 5: 140,625,141 K97N Het
Ubr4 A G 4: 139,415,083 E38G Het
Ugt2b37 T C 5: 87,254,259 Y171C probably damaging Het
Unc5b C A 10: 60,765,241 M935I probably benign Het
Usp34 T C 11: 23,412,314 S1606P Het
Vmn1r195 T C 13: 22,279,074 L238P probably damaging Het
Vmn2r85 T A 10: 130,425,212 M419L probably benign Het
Washc2 G T 6: 116,259,059 A1164S probably benign Het
Wdfy3 A T 5: 101,895,074 M1937K probably benign Het
Wdfy3 A T 5: 101,951,399 L261* probably null Het
Wdr64 A T 1: 175,731,526 Y285F probably benign Het
Wtap A G 17: 12,980,910 L62P probably damaging Het
Zfp94 C A 7: 24,303,073 V315F probably benign Het
Zhx1 A T 15: 58,048,402 probably null Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8290:Kit UTSW 5 75641169 missense probably benign
R8829:Kit UTSW 5 75639131 missense probably benign 0.41
R8832:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATTGTGTTATTCAAGCTTGTAAT -3'
(R):5'- CTGAGCAGCACAGCGGAC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCTGAGGCG -3'
(R):5'- CACAGAGCCGGTGGTAGG -3'
Posted On2019-11-26