Incidental Mutation 'R7810:Ttyh3'
ID601078
Institutional Source Beutler Lab
Gene Symbol Ttyh3
Ensembl Gene ENSMUSG00000036565
Gene Nametweety family member 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7810 (G1)
Quality Score141.008
Status Not validated
Chromosome5
Chromosomal Location140620578-140649031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140625141 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 97 (K97N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042661] [ENSMUST00000197452]
Predicted Effect probably benign
Transcript: ENSMUST00000042661
SMART Domains Protein: ENSMUSP00000037447
Gene: ENSMUSG00000036565

DomainStartEndE-ValueType
Pfam:Tweety 25 430 9.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197452
SMART Domains Protein: ENSMUSP00000142655
Gene: ENSMUSG00000036565

DomainStartEndE-ValueType
Pfam:Tweety 25 430 1.8e-182 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,677,304 Y93* probably null Het
Adam34 T C 8: 43,652,008 E200G probably benign Het
Ankfy1 C T 11: 72,754,455 Q787* probably null Het
BC003331 T C 1: 150,392,908 probably benign Het
Birc6 T A 17: 74,548,820 H208Q probably damaging Het
Cabp5 T A 7: 13,398,338 F11I possibly damaging Het
Casc1 T G 6: 145,194,586 D163A probably benign Het
Ccdc88a T C 11: 29,485,964 Y1296H probably damaging Het
Ccdc88b A G 19: 6,849,086 V1087A probably benign Het
Cct3 C T 3: 88,321,135 T508I probably damaging Het
Ceacam9 T A 7: 16,723,733 M57K possibly damaging Het
Ces1f T C 8: 93,256,918 E487G probably damaging Het
Chd5 A G 4: 152,358,575 K278E probably damaging Het
Cntnap3 T A 13: 64,793,308 H286L possibly damaging Het
Efr3a G T 15: 65,787,173 probably benign Het
Fam208b T C 13: 3,575,714 K1412R possibly damaging Het
Fastkd2 T A 1: 63,731,692 I69N possibly damaging Het
Flg2 T C 3: 93,200,241 I11T possibly damaging Het
Folr2 T C 7: 101,840,895 M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 F360S probably damaging Het
Galr2 T C 11: 116,283,120 V192A probably benign Het
Gas6 A T 8: 13,466,809 I563N probably damaging Het
Gbe1 T C 16: 70,527,197 F567L possibly damaging Het
Gm12695 G A 4: 96,731,371 H423Y probably damaging Het
Gm14548 C A 7: 3,894,205 C544F probably damaging Het
Gm6902 T C 7: 23,273,818 T95A probably benign Het
Gpr155 G T 2: 73,381,952 A109D probably damaging Het
Hsdl1 T C 8: 119,567,972 D5G probably damaging Het
Hyal1 C T 9: 107,578,429 P313S probably damaging Het
Igfn1 G A 1: 135,974,789 T390M probably damaging Het
Irx1 C A 13: 71,959,798 R255L probably benign Het
Itga2 T A 13: 114,866,179 T592S probably benign Het
Kit C A 5: 75,609,322 S131R probably benign Het
Map1b T C 13: 99,431,882 T1444A unknown Het
Mapk8ip1 C T 2: 92,389,151 E112K probably benign Het
Marveld3 T C 8: 109,954,634 I210V probably damaging Het
Masp1 T A 16: 23,476,318 I398L probably benign Het
Mmrn1 T C 6: 60,976,325 I530T probably benign Het
Mtss1l A G 8: 110,726,201 Y26C probably damaging Het
Myo5a T A 9: 75,160,465 S600R probably benign Het
Myo5a A G 9: 75,169,010 I836V probably benign Het
Naaladl1 A G 19: 6,109,664 D375G probably damaging Het
Napepld T A 5: 21,683,265 D62V possibly damaging Het
Nedd9 A C 13: 41,312,007 I719S possibly damaging Het
Nes T A 3: 87,975,616 M394K probably benign Het
Nlrc5 A T 8: 94,505,144 Y1288F possibly damaging Het
Nlrp14 T A 7: 107,192,575 C822* probably null Het
Noa1 A C 5: 77,309,224 L278R probably damaging Het
Nop16 A G 13: 54,590,076 probably benign Het
Olfr1448 A G 19: 12,919,865 V148A probably benign Het
Olfr746 A T 14: 50,653,993 Y252F probably benign Het
Osbpl10 C T 9: 115,061,894 H117Y probably benign Het
Oxct1 A T 15: 4,047,576 E130D probably benign Het
Padi2 A G 4: 140,949,264 E571G possibly damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Pdcd11 G A 19: 47,098,220 E222K possibly damaging Het
Plekha2 A G 8: 25,088,340 probably null Het
Pogz T C 3: 94,870,107 L366P probably benign Het
Ppp4r3b A G 11: 29,188,086 I145V probably benign Het
Ptprk T A 10: 28,592,857 H1438Q probably damaging Het
Rbm4 A T 19: 4,792,622 V63E possibly damaging Het
Sbk2 T A 7: 4,958,939 H116L probably damaging Het
Sdk1 A G 5: 141,937,679 T352A probably benign Het
Sept9 T A 11: 117,359,438 C529* probably null Het
Setx T A 2: 29,148,651 V1716D probably benign Het
Slc19a3 C T 1: 83,019,441 V349I probably benign Het
Slc27a4 C A 2: 29,805,710 R86S probably benign Het
Slc4a8 A G 15: 100,798,178 H613R possibly damaging Het
Smoc2 A G 17: 14,325,622 R58G probably damaging Het
Sphkap T A 1: 83,276,300 N1243Y probably damaging Het
Srsf5 T C 12: 80,949,946 S261P unknown Het
Tab1 A T 15: 80,158,798 T398S possibly damaging Het
Tas2r131 T A 6: 132,957,742 T35S probably benign Het
Tigd4 T A 3: 84,595,003 V409E possibly damaging Het
Tlr12 T C 4: 128,616,708 Q583R probably benign Het
Tmprss9 T A 10: 80,897,311 C894S unknown Het
Topaz1 T A 9: 122,749,185 S387T probably benign Het
Tsfm T C 10: 127,011,689 R178G probably benign Het
Ttll13 T C 7: 80,253,127 I181T probably damaging Het
Ubr4 A G 4: 139,415,083 E38G Het
Ugt2b37 T C 5: 87,254,259 Y171C probably damaging Het
Unc5b C A 10: 60,765,241 M935I probably benign Het
Usp34 T C 11: 23,412,314 S1606P Het
Vmn1r195 T C 13: 22,279,074 L238P probably damaging Het
Vmn2r85 T A 10: 130,425,212 M419L probably benign Het
Washc2 G T 6: 116,259,059 A1164S probably benign Het
Wdfy3 A T 5: 101,895,074 M1937K probably benign Het
Wdfy3 A T 5: 101,951,399 L261* probably null Het
Wdr64 A T 1: 175,731,526 Y285F probably benign Het
Wtap A G 17: 12,980,910 L62P probably damaging Het
Zfp94 C A 7: 24,303,073 V315F probably benign Het
Other mutations in Ttyh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ttyh3 APN 5 140629412 missense probably damaging 0.99
IGL01324:Ttyh3 APN 5 140631513 missense probably benign 0.00
IGL01982:Ttyh3 APN 5 140636074 splice site probably benign
IGL02002:Ttyh3 APN 5 140629483 missense probably damaging 1.00
IGL02218:Ttyh3 APN 5 140626491 missense probably damaging 1.00
IGL02385:Ttyh3 APN 5 140633305 missense probably benign 0.03
IGL02510:Ttyh3 APN 5 140629464 missense probably damaging 1.00
R0843:Ttyh3 UTSW 5 140626446 splice site probably null
R3037:Ttyh3 UTSW 5 140648842 start gained probably benign
R3774:Ttyh3 UTSW 5 140648734 missense probably damaging 0.99
R4795:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4796:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4868:Ttyh3 UTSW 5 140629466 missense probably damaging 1.00
R5671:Ttyh3 UTSW 5 140631552 missense probably benign 0.02
R6107:Ttyh3 UTSW 5 140633562 critical splice donor site probably null
R6363:Ttyh3 UTSW 5 140635224 missense probably damaging 1.00
R7104:Ttyh3 UTSW 5 140629785 missense probably benign 0.00
R7454:Ttyh3 UTSW 5 140629425 missense possibly damaging 0.95
R7798:Ttyh3 UTSW 5 140634783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGATGACAGAGTCAGG -3'
(R):5'- CTGTGTCACATTCGACTGCC -3'

Sequencing Primer
(F):5'- TACCCTGTGACATCAGTGGG -3'
(R):5'- GTCACATTCGACTGCCCTCAC -3'
Posted On2019-11-26