Incidental Mutation 'R7810:Sdk1'
ID601079
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7810 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141937679 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 352 (T352A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: T92A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T92A

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: T352A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T352A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,677,304 Y93* probably null Het
Adam34 T C 8: 43,652,008 E200G probably benign Het
Ankfy1 C T 11: 72,754,455 Q787* probably null Het
BC003331 T C 1: 150,392,908 probably benign Het
Birc6 T A 17: 74,548,820 H208Q probably damaging Het
Cabp5 T A 7: 13,398,338 F11I possibly damaging Het
Casc1 T G 6: 145,194,586 D163A probably benign Het
Ccdc88a T C 11: 29,485,964 Y1296H probably damaging Het
Ccdc88b A G 19: 6,849,086 V1087A probably benign Het
Cct3 C T 3: 88,321,135 T508I probably damaging Het
Ceacam9 T A 7: 16,723,733 M57K possibly damaging Het
Ces1f T C 8: 93,256,918 E487G probably damaging Het
Chd5 A G 4: 152,358,575 K278E probably damaging Het
Cntnap3 T A 13: 64,793,308 H286L possibly damaging Het
Efr3a G T 15: 65,787,173 probably benign Het
Fam208b T C 13: 3,575,714 K1412R possibly damaging Het
Fastkd2 T A 1: 63,731,692 I69N possibly damaging Het
Flg2 T C 3: 93,200,241 I11T possibly damaging Het
Folr2 T C 7: 101,840,895 M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 F360S probably damaging Het
Galr2 T C 11: 116,283,120 V192A probably benign Het
Gas6 A T 8: 13,466,809 I563N probably damaging Het
Gbe1 T C 16: 70,527,197 F567L possibly damaging Het
Gm12695 G A 4: 96,731,371 H423Y probably damaging Het
Gm14548 C A 7: 3,894,205 C544F probably damaging Het
Gm6902 T C 7: 23,273,818 T95A probably benign Het
Gpr155 G T 2: 73,381,952 A109D probably damaging Het
Hsdl1 T C 8: 119,567,972 D5G probably damaging Het
Hyal1 C T 9: 107,578,429 P313S probably damaging Het
Igfn1 G A 1: 135,974,789 T390M probably damaging Het
Irx1 C A 13: 71,959,798 R255L probably benign Het
Itga2 T A 13: 114,866,179 T592S probably benign Het
Kit C A 5: 75,609,322 S131R probably benign Het
Map1b T C 13: 99,431,882 T1444A unknown Het
Mapk8ip1 C T 2: 92,389,151 E112K probably benign Het
Marveld3 T C 8: 109,954,634 I210V probably damaging Het
Masp1 T A 16: 23,476,318 I398L probably benign Het
Mmrn1 T C 6: 60,976,325 I530T probably benign Het
Mtss1l A G 8: 110,726,201 Y26C probably damaging Het
Myo5a T A 9: 75,160,465 S600R probably benign Het
Myo5a A G 9: 75,169,010 I836V probably benign Het
Naaladl1 A G 19: 6,109,664 D375G probably damaging Het
Napepld T A 5: 21,683,265 D62V possibly damaging Het
Nedd9 A C 13: 41,312,007 I719S possibly damaging Het
Nes T A 3: 87,975,616 M394K probably benign Het
Nlrc5 A T 8: 94,505,144 Y1288F possibly damaging Het
Nlrp14 T A 7: 107,192,575 C822* probably null Het
Noa1 A C 5: 77,309,224 L278R probably damaging Het
Nop16 A G 13: 54,590,076 probably benign Het
Olfr1448 A G 19: 12,919,865 V148A probably benign Het
Olfr746 A T 14: 50,653,993 Y252F probably benign Het
Osbpl10 C T 9: 115,061,894 H117Y probably benign Het
Oxct1 A T 15: 4,047,576 E130D probably benign Het
Padi2 A G 4: 140,949,264 E571G possibly damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Pdcd11 G A 19: 47,098,220 E222K possibly damaging Het
Plekha2 A G 8: 25,088,340 probably null Het
Pogz T C 3: 94,870,107 L366P probably benign Het
Ppp4r3b A G 11: 29,188,086 I145V probably benign Het
Ptprk T A 10: 28,592,857 H1438Q probably damaging Het
Rbm4 A T 19: 4,792,622 V63E possibly damaging Het
Sbk2 T A 7: 4,958,939 H116L probably damaging Het
Sept9 T A 11: 117,359,438 C529* probably null Het
Setx T A 2: 29,148,651 V1716D probably benign Het
Slc19a3 C T 1: 83,019,441 V349I probably benign Het
Slc27a4 C A 2: 29,805,710 R86S probably benign Het
Slc4a8 A G 15: 100,798,178 H613R possibly damaging Het
Smoc2 A G 17: 14,325,622 R58G probably damaging Het
Sphkap T A 1: 83,276,300 N1243Y probably damaging Het
Srsf5 T C 12: 80,949,946 S261P unknown Het
Tab1 A T 15: 80,158,798 T398S possibly damaging Het
Tas2r131 T A 6: 132,957,742 T35S probably benign Het
Tigd4 T A 3: 84,595,003 V409E possibly damaging Het
Tlr12 T C 4: 128,616,708 Q583R probably benign Het
Tmprss9 T A 10: 80,897,311 C894S unknown Het
Topaz1 T A 9: 122,749,185 S387T probably benign Het
Tsfm T C 10: 127,011,689 R178G probably benign Het
Ttll13 T C 7: 80,253,127 I181T probably damaging Het
Ttyh3 T A 5: 140,625,141 K97N Het
Ubr4 A G 4: 139,415,083 E38G Het
Ugt2b37 T C 5: 87,254,259 Y171C probably damaging Het
Unc5b C A 10: 60,765,241 M935I probably benign Het
Usp34 T C 11: 23,412,314 S1606P Het
Vmn1r195 T C 13: 22,279,074 L238P probably damaging Het
Vmn2r85 T A 10: 130,425,212 M419L probably benign Het
Washc2 G T 6: 116,259,059 A1164S probably benign Het
Wdfy3 A T 5: 101,895,074 M1937K probably benign Het
Wdfy3 A T 5: 101,951,399 L261* probably null Het
Wdr64 A T 1: 175,731,526 Y285F probably benign Het
Wtap A G 17: 12,980,910 L62P probably damaging Het
Zfp94 C A 7: 24,303,073 V315F probably benign Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense not run
Z1177:Sdk1 UTSW 5 141962708 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGAAATTATTATTACTGCCGTCCAC -3'
(R):5'- CTGTGTGCAGAGGTGGCAC -3'

Sequencing Primer
(F):5'- TGCCGTCCACGTGATTCG -3'
(R):5'- CACGTGCACAAATACATCAGGTCAG -3'
Posted On2019-11-26