Mutagenetix > Incidental Mutation

Incidental Mutation 'R7810:Ptprk'

601106

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28592857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1438 (H1438Q)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]

AlphaFold

P35822

Predicted Effect

probably benign
Transcript: ENSMUST00000166468
AA Change: H1424Q

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: H1424Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218276
AA Change: H1438Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000218359
AA Change: H1412Q

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000220357

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,677,304	Y93*	probably null	Het
Adam34	T	C	8: 43,652,008	E200G	probably benign	Het
Ankfy1	C	T	11: 72,754,455	Q787*	probably null	Het
BC003331	T	C	1: 150,392,908		probably benign	Het
Birc6	T	A	17: 74,548,820	H208Q	probably damaging	Het
Brsk2	T	A	7: 141,985,420		probably null	Het
Cabp5	T	A	7: 13,398,338	F11I	possibly damaging	Het
Casc1	T	G	6: 145,194,586	D163A	probably benign	Het
Ccdc88a	T	C	11: 29,485,964	Y1296H	probably damaging	Het
Ccdc88b	A	G	19: 6,849,086	V1087A	probably benign	Het
Cct3	C	T	3: 88,321,135	T508I	probably damaging	Het
Ceacam9	T	A	7: 16,723,733	M57K	possibly damaging	Het
Ces1f	T	C	8: 93,256,918	E487G	probably damaging	Het
Chd5	A	G	4: 152,358,575	K278E	probably damaging	Het
Cntnap3	T	A	13: 64,793,308	H286L	possibly damaging	Het
Efr3a	G	T	15: 65,787,173		probably benign	Het
Fam208b	T	C	13: 3,575,714	K1412R	possibly damaging	Het
Fastkd2	T	A	1: 63,731,692	I69N	possibly damaging	Het
Flg2	T	C	3: 93,200,241	I11T	possibly damaging	Het
Folr2	T	C	7: 101,840,895	M84V	possibly damaging	Het
Galnt12	T	C	4: 47,113,786	F360S	probably damaging	Het
Galr2	T	C	11: 116,283,120	V192A	probably benign	Het
Gas6	A	T	8: 13,466,809	I563N	probably damaging	Het
Gbe1	T	C	16: 70,527,197	F567L	possibly damaging	Het
Gm12695	G	A	4: 96,731,371	H423Y	probably damaging	Het
Gm14548	C	A	7: 3,894,205	C544F	probably damaging	Het
Gm6902	T	C	7: 23,273,818	T95A	probably benign	Het
Gpr155	G	T	2: 73,381,952	A109D	probably damaging	Het
Hsdl1	T	C	8: 119,567,972	D5G	probably damaging	Het
Hyal1	C	T	9: 107,578,429	P313S	probably damaging	Het
Igfn1	G	A	1: 135,974,789	T390M	probably damaging	Het
Irx1	C	A	13: 71,959,798	R255L	probably benign	Het
Itga2	T	A	13: 114,866,179	T592S	probably benign	Het
Kit	C	A	5: 75,609,322	S131R	probably benign	Het
Map1b	T	C	13: 99,431,882	T1444A	unknown	Het
Mapk8ip1	C	T	2: 92,389,151	E112K	probably benign	Het
Marveld3	T	C	8: 109,954,634	I210V	probably damaging	Het
Masp1	T	A	16: 23,476,318	I398L	probably benign	Het
Mmrn1	T	C	6: 60,976,325	I530T	probably benign	Het
Mtss1l	A	G	8: 110,726,201	Y26C	probably damaging	Het
Myo5a	T	A	9: 75,160,465	S600R	probably benign	Het
Myo5a	A	G	9: 75,169,010	I836V	probably benign	Het
Naaladl1	A	G	19: 6,109,664	D375G	probably damaging	Het
Napepld	T	A	5: 21,683,265	D62V	possibly damaging	Het
Nedd9	A	C	13: 41,312,007	I719S	possibly damaging	Het
Nes	T	A	3: 87,975,616	M394K	probably benign	Het
Nlrc5	A	T	8: 94,505,144	Y1288F	possibly damaging	Het
Nlrp14	T	A	7: 107,192,575	C822*	probably null	Het
Noa1	A	C	5: 77,309,224	L278R	probably damaging	Het
Nop16	A	G	13: 54,590,076		probably benign	Het
Olfr1448	A	G	19: 12,919,865	V148A	probably benign	Het
Olfr746	A	T	14: 50,653,993	Y252F	probably benign	Het
Osbpl10	C	T	9: 115,061,894	H117Y	probably benign	Het
Oxct1	A	T	15: 4,047,576	E130D	probably benign	Het
Padi2	A	G	4: 140,949,264	E571G	possibly damaging	Het
Pcdhac2	G	A	18: 37,145,664	V566M	probably benign	Het
Pdcd11	G	A	19: 47,098,220	E222K	possibly damaging	Het
Plekha2	A	G	8: 25,088,340		probably null	Het
Pogz	T	C	3: 94,870,107	L366P	probably benign	Het
Ppp4r3b	A	G	11: 29,188,086	I145V	probably benign	Het
Prkcd	A	G	14: 30,598,450		probably null	Het
Rbm4	A	T	19: 4,792,622	V63E	possibly damaging	Het
Sbk2	T	A	7: 4,958,939	H116L	probably damaging	Het
Sdk1	A	G	5: 141,937,679	T352A	probably benign	Het
Sept9	T	A	11: 117,359,438	C529*	probably null	Het
Setx	T	A	2: 29,148,651	V1716D	probably benign	Het
Slc19a3	C	T	1: 83,019,441	V349I	probably benign	Het
Slc27a4	C	A	2: 29,805,710	R86S	probably benign	Het
Slc4a8	A	G	15: 100,798,178	H613R	possibly damaging	Het
Smoc2	A	G	17: 14,325,622	R58G	probably damaging	Het
Sphkap	T	A	1: 83,276,300	N1243Y	probably damaging	Het
Srsf5	T	C	12: 80,949,946	S261P	unknown	Het
Tab1	A	T	15: 80,158,798	T398S	possibly damaging	Het
Tas2r131	T	A	6: 132,957,742	T35S	probably benign	Het
Tigd4	T	A	3: 84,595,003	V409E	possibly damaging	Het
Tlr12	T	C	4: 128,616,708	Q583R	probably benign	Het
Tmprss9	T	A	10: 80,897,311	C894S	unknown	Het
Topaz1	T	A	9: 122,749,185	S387T	probably benign	Het
Tsfm	T	C	10: 127,011,689	R178G	probably benign	Het
Ttll13	T	C	7: 80,253,127	I181T	probably damaging	Het
Ttyh3	T	A	5: 140,625,141	K97N		Het
Ubr4	A	G	4: 139,415,083	E38G		Het
Ugt2b37	T	C	5: 87,254,259	Y171C	probably damaging	Het
Unc5b	C	A	10: 60,765,241	M935I	probably benign	Het
Usp34	T	C	11: 23,412,314	S1606P		Het
Vmn1r195	T	C	13: 22,279,074	L238P	probably damaging	Het
Vmn2r85	T	A	10: 130,425,212	M419L	probably benign	Het
Washc2	G	T	6: 116,259,059	A1164S	probably benign	Het
Wdfy3	A	T	5: 101,895,074	M1937K	probably benign	Het
Wdfy3	A	T	5: 101,951,399	L261*	probably null	Het
Wdr64	A	T	1: 175,731,526	Y285F	probably benign	Het
Wtap	A	G	17: 12,980,910	L62P	probably damaging	Het
Zfp94	C	A	7: 24,303,073	V315F	probably benign	Het
Zhx1	A	T	15: 58,048,402		probably null	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
R9475:Ptprk	UTSW	10	28334480	missense	possibly damaging	0.60
R9585:Ptprk	UTSW	10	28493151	nonsense	probably null
R9625:Ptprk	UTSW	10	28586010	missense	probably damaging	0.99
R9700:Ptprk	UTSW	10	28580499	missense	probably damaging	1.00
R9745:Ptprk	UTSW	10	28263612	missense	possibly damaging	0.46
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATAAGTGTCCTTTCCCAGG -3'
(R):5'- CCAACAGGTTATGTGATGGGG -3'

Sequencing Primer
(F):5'- CTTTCCCAGGAGAGTGTGATG -3'
(R):5'- TGGGGAATGCATTTATACAGGC -3'

Posted On

2019-11-26