Incidental Mutation 'R7810:Map1b'
ID 601124
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 045865-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7810 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99568390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1444 (T1444A)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: T1444A
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1444A

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 44,105,045 (GRCm39) E200G probably benign Het
Ankfy1 C T 11: 72,645,281 (GRCm39) Q787* probably null Het
Birc6 T A 17: 74,855,815 (GRCm39) H208Q probably damaging Het
Brsk2 T A 7: 141,539,157 (GRCm39) probably null Het
Cabp5 T A 7: 13,132,263 (GRCm39) F11I possibly damaging Het
Ccdc88a T C 11: 29,435,964 (GRCm39) Y1296H probably damaging Het
Ccdc88b A G 19: 6,826,454 (GRCm39) V1087A probably benign Het
Cct3 C T 3: 88,228,442 (GRCm39) T508I probably damaging Het
Ceacam9 T A 7: 16,457,658 (GRCm39) M57K possibly damaging Het
Ces1f T C 8: 93,983,546 (GRCm39) E487G probably damaging Het
Chd5 A G 4: 152,443,032 (GRCm39) K278E probably damaging Het
Cntnap3 T A 13: 64,941,122 (GRCm39) H286L possibly damaging Het
Dnai7 T G 6: 145,140,312 (GRCm39) D163A probably benign Het
Efr3a G T 15: 65,659,022 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,770,851 (GRCm39) I69N possibly damaging Het
Flg2 T C 3: 93,107,548 (GRCm39) I11T possibly damaging Het
Folr2 T C 7: 101,490,102 (GRCm39) M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 (GRCm39) F360S probably damaging Het
Galr2 T C 11: 116,173,946 (GRCm39) V192A probably benign Het
Gas6 A T 8: 13,516,809 (GRCm39) I563N probably damaging Het
Gbe1 T C 16: 70,324,085 (GRCm39) F567L possibly damaging Het
Gm12695 G A 4: 96,619,608 (GRCm39) H423Y probably damaging Het
Gm6902 T C 7: 22,973,243 (GRCm39) T95A probably benign Het
Gpr155 G T 2: 73,212,296 (GRCm39) A109D probably damaging Het
Hsdl1 T C 8: 120,294,711 (GRCm39) D5G probably damaging Het
Hyal1 C T 9: 107,455,628 (GRCm39) P313S probably damaging Het
Igfn1 G A 1: 135,902,527 (GRCm39) T390M probably damaging Het
Irx1 C A 13: 72,107,917 (GRCm39) R255L probably benign Het
Itga2 T A 13: 115,002,715 (GRCm39) T592S probably benign Het
Kit C A 5: 75,769,982 (GRCm39) S131R probably benign Het
Mapk8ip1 C T 2: 92,219,496 (GRCm39) E112K probably benign Het
Marveld3 T C 8: 110,681,266 (GRCm39) I210V probably damaging Het
Masp1 T A 16: 23,295,068 (GRCm39) I398L probably benign Het
Mmrn1 T C 6: 60,953,309 (GRCm39) I530T probably benign Het
Mtss2 A G 8: 111,452,833 (GRCm39) Y26C probably damaging Het
Myo5a T A 9: 75,067,747 (GRCm39) S600R probably benign Het
Myo5a A G 9: 75,076,292 (GRCm39) I836V probably benign Het
Naaladl1 A G 19: 6,159,694 (GRCm39) D375G probably damaging Het
Napepld T A 5: 21,888,263 (GRCm39) D62V possibly damaging Het
Nedd9 A C 13: 41,465,483 (GRCm39) I719S possibly damaging Het
Nes T A 3: 87,882,923 (GRCm39) M394K probably benign Het
Nlrc5 A T 8: 95,231,772 (GRCm39) Y1288F possibly damaging Het
Nlrp14 T A 7: 106,791,782 (GRCm39) C822* probably null Het
Noa1 A C 5: 77,457,071 (GRCm39) L278R probably damaging Het
Nop16 A G 13: 54,737,889 (GRCm39) probably benign Het
Odr4 T C 1: 150,268,659 (GRCm39) probably benign Het
Or11h7 A T 14: 50,891,450 (GRCm39) Y252F probably benign Het
Or5b12 A G 19: 12,897,229 (GRCm39) V148A probably benign Het
Osbpl10 C T 9: 114,890,962 (GRCm39) H117Y probably benign Het
Oxct1 A T 15: 4,077,058 (GRCm39) E130D probably benign Het
Padi2 A G 4: 140,676,575 (GRCm39) E571G possibly damaging Het
Pcdhac2 G A 18: 37,278,717 (GRCm39) V566M probably benign Het
Pdcd11 G A 19: 47,086,659 (GRCm39) E222K possibly damaging Het
Pira12 C A 7: 3,897,204 (GRCm39) C544F probably damaging Het
Plekha2 A G 8: 25,578,356 (GRCm39) probably null Het
Pogz T C 3: 94,777,418 (GRCm39) L366P probably benign Het
Ppp4r3b A G 11: 29,138,086 (GRCm39) I145V probably benign Het
Prkcd A G 14: 30,320,407 (GRCm39) probably null Het
Ptprk T A 10: 28,468,853 (GRCm39) H1438Q probably damaging Het
Rbm4 A T 19: 4,842,650 (GRCm39) V63E possibly damaging Het
Sbk2 T A 7: 4,961,938 (GRCm39) H116L probably damaging Het
Sdk1 A G 5: 141,923,434 (GRCm39) T352A probably benign Het
Septin9 T A 11: 117,250,264 (GRCm39) C529* probably null Het
Setx T A 2: 29,038,663 (GRCm39) V1716D probably benign Het
Slc19a3 C T 1: 82,997,162 (GRCm39) V349I probably benign Het
Slc27a4 C A 2: 29,695,722 (GRCm39) R86S probably benign Het
Slc4a8 A G 15: 100,696,059 (GRCm39) H613R possibly damaging Het
Smoc2 A G 17: 14,545,884 (GRCm39) R58G probably damaging Het
Sphkap T A 1: 83,254,021 (GRCm39) N1243Y probably damaging Het
Srsf5 T C 12: 80,996,720 (GRCm39) S261P unknown Het
Tab1 A T 15: 80,042,999 (GRCm39) T398S possibly damaging Het
Tas2r131 T A 6: 132,934,705 (GRCm39) T35S probably benign Het
Tasor2 T C 13: 3,625,714 (GRCm39) K1412R possibly damaging Het
Tigd4 T A 3: 84,502,310 (GRCm39) V409E possibly damaging Het
Tlr12 T C 4: 128,510,501 (GRCm39) Q583R probably benign Het
Tmprss9 T A 10: 80,733,145 (GRCm39) C894S unknown Het
Topaz1 T A 9: 122,578,250 (GRCm39) S387T probably benign Het
Tsfm T C 10: 126,847,558 (GRCm39) R178G probably benign Het
Ttll13 T C 7: 79,902,875 (GRCm39) I181T probably damaging Het
Ttyh3 T A 5: 140,610,896 (GRCm39) K97N Het
Ubr4 A G 4: 139,142,394 (GRCm39) E38G Het
Ugt2b37 T C 5: 87,402,118 (GRCm39) Y171C probably damaging Het
Unc5b C A 10: 60,601,020 (GRCm39) M935I probably benign Het
Usp34 T C 11: 23,362,314 (GRCm39) S1606P Het
Vmn1r195 T C 13: 22,463,244 (GRCm39) L238P probably damaging Het
Vmn2r85 T A 10: 130,261,081 (GRCm39) M419L probably benign Het
Washc2 G T 6: 116,236,020 (GRCm39) A1164S probably benign Het
Wdfy3 A T 5: 102,042,940 (GRCm39) M1937K probably benign Het
Wdfy3 A T 5: 102,099,265 (GRCm39) L261* probably null Het
Wdr64 A T 1: 175,559,092 (GRCm39) Y285F probably benign Het
Wtap A G 17: 13,199,797 (GRCm39) L62P probably damaging Het
Zfp1007 A C 5: 109,825,170 (GRCm39) Y93* probably null Het
Zfp94 C A 7: 24,002,498 (GRCm39) V315F probably benign Het
Zhx1 A T 15: 57,911,798 (GRCm39) probably null Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCTTCTGAAATGGACATCTTGG -3'
(R):5'- GAAGGTTCTGTCTCCTTTACGC -3'

Sequencing Primer
(F):5'- GAGCCAAACTGACTGACGTCTATTTG -3'
(R):5'- GCAGTCCTCCCCTTCTTGGATC -3'
Posted On 2019-11-26