Incidental Mutation 'R7810:Map1b'
ID601124
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Namemicrotubule-associated protein 1B
SynonymsMtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7810 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99421446-99516540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99431882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1444 (T1444A)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: T1444A
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1444A

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,677,304 Y93* probably null Het
Adam34 T C 8: 43,652,008 E200G probably benign Het
Ankfy1 C T 11: 72,754,455 Q787* probably null Het
BC003331 T C 1: 150,392,908 probably benign Het
Birc6 T A 17: 74,548,820 H208Q probably damaging Het
Brsk2 T A 7: 141,985,420 probably null Het
Cabp5 T A 7: 13,398,338 F11I possibly damaging Het
Casc1 T G 6: 145,194,586 D163A probably benign Het
Ccdc88a T C 11: 29,485,964 Y1296H probably damaging Het
Ccdc88b A G 19: 6,849,086 V1087A probably benign Het
Cct3 C T 3: 88,321,135 T508I probably damaging Het
Ceacam9 T A 7: 16,723,733 M57K possibly damaging Het
Ces1f T C 8: 93,256,918 E487G probably damaging Het
Chd5 A G 4: 152,358,575 K278E probably damaging Het
Cntnap3 T A 13: 64,793,308 H286L possibly damaging Het
Efr3a G T 15: 65,787,173 probably benign Het
Fam208b T C 13: 3,575,714 K1412R possibly damaging Het
Fastkd2 T A 1: 63,731,692 I69N possibly damaging Het
Flg2 T C 3: 93,200,241 I11T possibly damaging Het
Folr2 T C 7: 101,840,895 M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 F360S probably damaging Het
Galr2 T C 11: 116,283,120 V192A probably benign Het
Gas6 A T 8: 13,466,809 I563N probably damaging Het
Gbe1 T C 16: 70,527,197 F567L possibly damaging Het
Gm12695 G A 4: 96,731,371 H423Y probably damaging Het
Gm14548 C A 7: 3,894,205 C544F probably damaging Het
Gm6902 T C 7: 23,273,818 T95A probably benign Het
Gpr155 G T 2: 73,381,952 A109D probably damaging Het
Hsdl1 T C 8: 119,567,972 D5G probably damaging Het
Hyal1 C T 9: 107,578,429 P313S probably damaging Het
Igfn1 G A 1: 135,974,789 T390M probably damaging Het
Irx1 C A 13: 71,959,798 R255L probably benign Het
Itga2 T A 13: 114,866,179 T592S probably benign Het
Kit C A 5: 75,609,322 S131R probably benign Het
Mapk8ip1 C T 2: 92,389,151 E112K probably benign Het
Marveld3 T C 8: 109,954,634 I210V probably damaging Het
Masp1 T A 16: 23,476,318 I398L probably benign Het
Mmrn1 T C 6: 60,976,325 I530T probably benign Het
Mtss1l A G 8: 110,726,201 Y26C probably damaging Het
Myo5a T A 9: 75,160,465 S600R probably benign Het
Myo5a A G 9: 75,169,010 I836V probably benign Het
Naaladl1 A G 19: 6,109,664 D375G probably damaging Het
Napepld T A 5: 21,683,265 D62V possibly damaging Het
Nedd9 A C 13: 41,312,007 I719S possibly damaging Het
Nes T A 3: 87,975,616 M394K probably benign Het
Nlrc5 A T 8: 94,505,144 Y1288F possibly damaging Het
Nlrp14 T A 7: 107,192,575 C822* probably null Het
Noa1 A C 5: 77,309,224 L278R probably damaging Het
Nop16 A G 13: 54,590,076 probably benign Het
Olfr1448 A G 19: 12,919,865 V148A probably benign Het
Olfr746 A T 14: 50,653,993 Y252F probably benign Het
Osbpl10 C T 9: 115,061,894 H117Y probably benign Het
Oxct1 A T 15: 4,047,576 E130D probably benign Het
Padi2 A G 4: 140,949,264 E571G possibly damaging Het
Pcdhac2 G A 18: 37,145,664 V566M probably benign Het
Pdcd11 G A 19: 47,098,220 E222K possibly damaging Het
Plekha2 A G 8: 25,088,340 probably null Het
Pogz T C 3: 94,870,107 L366P probably benign Het
Ppp4r3b A G 11: 29,188,086 I145V probably benign Het
Prkcd A G 14: 30,598,450 probably null Het
Ptprk T A 10: 28,592,857 H1438Q probably damaging Het
Rbm4 A T 19: 4,792,622 V63E possibly damaging Het
Sbk2 T A 7: 4,958,939 H116L probably damaging Het
Sdk1 A G 5: 141,937,679 T352A probably benign Het
Sept9 T A 11: 117,359,438 C529* probably null Het
Setx T A 2: 29,148,651 V1716D probably benign Het
Slc19a3 C T 1: 83,019,441 V349I probably benign Het
Slc27a4 C A 2: 29,805,710 R86S probably benign Het
Slc4a8 A G 15: 100,798,178 H613R possibly damaging Het
Smoc2 A G 17: 14,325,622 R58G probably damaging Het
Sphkap T A 1: 83,276,300 N1243Y probably damaging Het
Srsf5 T C 12: 80,949,946 S261P unknown Het
Tab1 A T 15: 80,158,798 T398S possibly damaging Het
Tas2r131 T A 6: 132,957,742 T35S probably benign Het
Tigd4 T A 3: 84,595,003 V409E possibly damaging Het
Tlr12 T C 4: 128,616,708 Q583R probably benign Het
Tmprss9 T A 10: 80,897,311 C894S unknown Het
Topaz1 T A 9: 122,749,185 S387T probably benign Het
Tsfm T C 10: 127,011,689 R178G probably benign Het
Ttll13 T C 7: 80,253,127 I181T probably damaging Het
Ttyh3 T A 5: 140,625,141 K97N Het
Ubr4 A G 4: 139,415,083 E38G Het
Ugt2b37 T C 5: 87,254,259 Y171C probably damaging Het
Unc5b C A 10: 60,765,241 M935I probably benign Het
Usp34 T C 11: 23,412,314 S1606P Het
Vmn1r195 T C 13: 22,279,074 L238P probably damaging Het
Vmn2r85 T A 10: 130,425,212 M419L probably benign Het
Washc2 G T 6: 116,259,059 A1164S probably benign Het
Wdfy3 A T 5: 101,895,074 M1937K probably benign Het
Wdfy3 A T 5: 101,951,399 L261* probably null Het
Wdr64 A T 1: 175,731,526 Y285F probably benign Het
Wtap A G 17: 12,980,910 L62P probably damaging Het
Zfp94 C A 7: 24,303,073 V315F probably benign Het
Zhx1 A T 15: 58,048,402 probably null Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCTTCTGAAATGGACATCTTGG -3'
(R):5'- GAAGGTTCTGTCTCCTTTACGC -3'

Sequencing Primer
(F):5'- GAGCCAAACTGACTGACGTCTATTTG -3'
(R):5'- GCAGTCCTCCCCTTCTTGGATC -3'
Posted On2019-11-26