Incidental Mutation 'R7810:Masp1'
ID 601131
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission 045865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R7810 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23295068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 398 (I398L)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619] [ENSMUST00000230040]
AlphaFold P98064
Predicted Effect probably benign
Transcript: ENSMUST00000089883
AA Change: I398L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: I398L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229619
AA Change: I398L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230040
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (91/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 44,105,045 (GRCm39) E200G probably benign Het
Ankfy1 C T 11: 72,645,281 (GRCm39) Q787* probably null Het
Birc6 T A 17: 74,855,815 (GRCm39) H208Q probably damaging Het
Brsk2 T A 7: 141,539,157 (GRCm39) probably null Het
Cabp5 T A 7: 13,132,263 (GRCm39) F11I possibly damaging Het
Ccdc88a T C 11: 29,435,964 (GRCm39) Y1296H probably damaging Het
Ccdc88b A G 19: 6,826,454 (GRCm39) V1087A probably benign Het
Cct3 C T 3: 88,228,442 (GRCm39) T508I probably damaging Het
Ceacam9 T A 7: 16,457,658 (GRCm39) M57K possibly damaging Het
Ces1f T C 8: 93,983,546 (GRCm39) E487G probably damaging Het
Chd5 A G 4: 152,443,032 (GRCm39) K278E probably damaging Het
Cntnap3 T A 13: 64,941,122 (GRCm39) H286L possibly damaging Het
Dnai7 T G 6: 145,140,312 (GRCm39) D163A probably benign Het
Efr3a G T 15: 65,659,022 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,770,851 (GRCm39) I69N possibly damaging Het
Flg2 T C 3: 93,107,548 (GRCm39) I11T possibly damaging Het
Folr2 T C 7: 101,490,102 (GRCm39) M84V possibly damaging Het
Galnt12 T C 4: 47,113,786 (GRCm39) F360S probably damaging Het
Galr2 T C 11: 116,173,946 (GRCm39) V192A probably benign Het
Gas6 A T 8: 13,516,809 (GRCm39) I563N probably damaging Het
Gbe1 T C 16: 70,324,085 (GRCm39) F567L possibly damaging Het
Gm12695 G A 4: 96,619,608 (GRCm39) H423Y probably damaging Het
Gm6902 T C 7: 22,973,243 (GRCm39) T95A probably benign Het
Gpr155 G T 2: 73,212,296 (GRCm39) A109D probably damaging Het
Hsdl1 T C 8: 120,294,711 (GRCm39) D5G probably damaging Het
Hyal1 C T 9: 107,455,628 (GRCm39) P313S probably damaging Het
Igfn1 G A 1: 135,902,527 (GRCm39) T390M probably damaging Het
Irx1 C A 13: 72,107,917 (GRCm39) R255L probably benign Het
Itga2 T A 13: 115,002,715 (GRCm39) T592S probably benign Het
Kit C A 5: 75,769,982 (GRCm39) S131R probably benign Het
Map1b T C 13: 99,568,390 (GRCm39) T1444A unknown Het
Mapk8ip1 C T 2: 92,219,496 (GRCm39) E112K probably benign Het
Marveld3 T C 8: 110,681,266 (GRCm39) I210V probably damaging Het
Mmrn1 T C 6: 60,953,309 (GRCm39) I530T probably benign Het
Mtss2 A G 8: 111,452,833 (GRCm39) Y26C probably damaging Het
Myo5a T A 9: 75,067,747 (GRCm39) S600R probably benign Het
Myo5a A G 9: 75,076,292 (GRCm39) I836V probably benign Het
Naaladl1 A G 19: 6,159,694 (GRCm39) D375G probably damaging Het
Napepld T A 5: 21,888,263 (GRCm39) D62V possibly damaging Het
Nedd9 A C 13: 41,465,483 (GRCm39) I719S possibly damaging Het
Nes T A 3: 87,882,923 (GRCm39) M394K probably benign Het
Nlrc5 A T 8: 95,231,772 (GRCm39) Y1288F possibly damaging Het
Nlrp14 T A 7: 106,791,782 (GRCm39) C822* probably null Het
Noa1 A C 5: 77,457,071 (GRCm39) L278R probably damaging Het
Nop16 A G 13: 54,737,889 (GRCm39) probably benign Het
Odr4 T C 1: 150,268,659 (GRCm39) probably benign Het
Or11h7 A T 14: 50,891,450 (GRCm39) Y252F probably benign Het
Or5b12 A G 19: 12,897,229 (GRCm39) V148A probably benign Het
Osbpl10 C T 9: 114,890,962 (GRCm39) H117Y probably benign Het
Oxct1 A T 15: 4,077,058 (GRCm39) E130D probably benign Het
Padi2 A G 4: 140,676,575 (GRCm39) E571G possibly damaging Het
Pcdhac2 G A 18: 37,278,717 (GRCm39) V566M probably benign Het
Pdcd11 G A 19: 47,086,659 (GRCm39) E222K possibly damaging Het
Pira12 C A 7: 3,897,204 (GRCm39) C544F probably damaging Het
Plekha2 A G 8: 25,578,356 (GRCm39) probably null Het
Pogz T C 3: 94,777,418 (GRCm39) L366P probably benign Het
Ppp4r3b A G 11: 29,138,086 (GRCm39) I145V probably benign Het
Prkcd A G 14: 30,320,407 (GRCm39) probably null Het
Ptprk T A 10: 28,468,853 (GRCm39) H1438Q probably damaging Het
Rbm4 A T 19: 4,842,650 (GRCm39) V63E possibly damaging Het
Sbk2 T A 7: 4,961,938 (GRCm39) H116L probably damaging Het
Sdk1 A G 5: 141,923,434 (GRCm39) T352A probably benign Het
Septin9 T A 11: 117,250,264 (GRCm39) C529* probably null Het
Setx T A 2: 29,038,663 (GRCm39) V1716D probably benign Het
Slc19a3 C T 1: 82,997,162 (GRCm39) V349I probably benign Het
Slc27a4 C A 2: 29,695,722 (GRCm39) R86S probably benign Het
Slc4a8 A G 15: 100,696,059 (GRCm39) H613R possibly damaging Het
Smoc2 A G 17: 14,545,884 (GRCm39) R58G probably damaging Het
Sphkap T A 1: 83,254,021 (GRCm39) N1243Y probably damaging Het
Srsf5 T C 12: 80,996,720 (GRCm39) S261P unknown Het
Tab1 A T 15: 80,042,999 (GRCm39) T398S possibly damaging Het
Tas2r131 T A 6: 132,934,705 (GRCm39) T35S probably benign Het
Tasor2 T C 13: 3,625,714 (GRCm39) K1412R possibly damaging Het
Tigd4 T A 3: 84,502,310 (GRCm39) V409E possibly damaging Het
Tlr12 T C 4: 128,510,501 (GRCm39) Q583R probably benign Het
Tmprss9 T A 10: 80,733,145 (GRCm39) C894S unknown Het
Topaz1 T A 9: 122,578,250 (GRCm39) S387T probably benign Het
Tsfm T C 10: 126,847,558 (GRCm39) R178G probably benign Het
Ttll13 T C 7: 79,902,875 (GRCm39) I181T probably damaging Het
Ttyh3 T A 5: 140,610,896 (GRCm39) K97N Het
Ubr4 A G 4: 139,142,394 (GRCm39) E38G Het
Ugt2b37 T C 5: 87,402,118 (GRCm39) Y171C probably damaging Het
Unc5b C A 10: 60,601,020 (GRCm39) M935I probably benign Het
Usp34 T C 11: 23,362,314 (GRCm39) S1606P Het
Vmn1r195 T C 13: 22,463,244 (GRCm39) L238P probably damaging Het
Vmn2r85 T A 10: 130,261,081 (GRCm39) M419L probably benign Het
Washc2 G T 6: 116,236,020 (GRCm39) A1164S probably benign Het
Wdfy3 A T 5: 102,042,940 (GRCm39) M1937K probably benign Het
Wdfy3 A T 5: 102,099,265 (GRCm39) L261* probably null Het
Wdr64 A T 1: 175,559,092 (GRCm39) Y285F probably benign Het
Wtap A G 17: 13,199,797 (GRCm39) L62P probably damaging Het
Zfp1007 A C 5: 109,825,170 (GRCm39) Y93* probably null Het
Zfp94 C A 7: 24,002,498 (GRCm39) V315F probably benign Het
Zhx1 A T 15: 57,911,798 (GRCm39) probably null Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5562:Masp1 UTSW 16 23,283,917 (GRCm39) splice site probably null
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23,273,675 (GRCm39) missense probably benign 0.01
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7069:Masp1 UTSW 16 23,271,205 (GRCm39) missense probably benign 0.20
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9599:Masp1 UTSW 16 23,271,698 (GRCm39) missense probably benign 0.16
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCAAATGATCCGCCTAAGGG -3'
(R):5'- TGGGCAATATGACTTCTCTCTG -3'

Sequencing Primer
(F):5'- GGGGAAAACACTTAGTATCATTTGC -3'
(R):5'- GCAATATGACTTCTCTCTGGAGTTG -3'
Posted On 2019-11-26