Mutagenetix > Incidental Mutations

Incidental Mutation 'R7811:Ass1'

601144

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7811 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31514741 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 345 (V345I)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably benign
Transcript: ENSMUST00000102840
AA Change: V345I

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: V345I

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	G	17: 24,397,388	T935A	probably benign	Het
Anxa7	A	T	14: 20,460,186	Y399N	probably benign	Het
Arhgef10l	G	T	4: 140,515,024	T1030K	possibly damaging	Het
Bms1	T	C	6: 118,403,138	D736G	probably damaging	Het
Cbx4	A	C	11: 119,081,572	C326G	probably benign	Het
Ccdc188	A	G	16: 18,218,450	E94G	probably benign	Het
Cdh5	A	G	8: 104,125,603	T117A	possibly damaging	Het
Cdk11b	A	G	4: 155,639,902	T326A	unknown	Het
Clec5a	C	T	6: 40,581,933	C73Y	probably damaging	Het
Cntrl	T	C	2: 35,162,861	M1126T	probably benign	Het
Diaph3	T	C	14: 86,981,624	D455G	probably damaging	Het
Eml2	T	A	7: 19,186,122	M117K	probably benign	Het
Ern1	A	T	11: 106,434,868	V112D	unknown	Het
Eya3	T	C	4: 132,711,961	I466T	possibly damaging	Het
Ffar1	A	G	7: 30,861,377	S32P	possibly damaging	Het
Fgb	T	C	3: 83,049,697	D22G	probably benign	Het
Fsip2	T	C	2: 82,998,453	Y6865H	possibly damaging	Het
Gbx1	T	C	5: 24,505,037	E270G	probably damaging	Het
Golga4	T	C	9: 118,532,575	L207P	probably damaging	Het
Hnrnpa1	T	C	15: 103,241,473	S54P	possibly damaging	Het
Htr4	A	G	18: 62,412,198	E18G	possibly damaging	Het
Ide	A	C	19: 37,330,511	L34R		Het
Ip6k3	A	T	17: 27,157,583	Y51*	probably null	Het
Keap1	A	G	9: 21,237,660	L17P	possibly damaging	Het
Lrrn2	T	C	1: 132,939,201	V668A	probably benign	Het
Lypd8	A	T	11: 58,390,238	T209S	possibly damaging	Het
Myo10	T	C	15: 25,804,524	I1635T	probably damaging	Het
Myo1e	T	A	9: 70,327,262	V299E	probably damaging	Het
Nadk	A	T	4: 155,576,875		probably benign	Het
Nalcn	A	T	14: 123,298,945	W1231R	probably damaging	Het
Odf2l	A	G	3: 145,153,387	T602A	probably benign	Het
Olfr309	T	A	7: 86,306,346	T256S	probably damaging	Het
Olfr457	T	A	6: 42,471,701	E159V	probably damaging	Het
Pde6c	T	C	19: 38,140,059	V190A	possibly damaging	Het
Ppp4r3a	C	A	12: 101,053,562	R378L	probably damaging	Het
Pus7l	A	C	15: 94,540,826	V46G	probably damaging	Het
Satb2	G	A	1: 56,845,721	S466L	probably benign	Het
Serpina6	A	G	12: 103,654,136	M118T	probably damaging	Het
Slc29a1	T	C	17: 45,586,263	R366G	probably damaging	Het
Slc6a1	T	C	6: 114,302,554	F98S	probably damaging	Het
Spg7	T	C	8: 123,097,425	I738T	possibly damaging	Het
Srcap	T	C	7: 127,542,049	V1667A	probably damaging	Het
Stxbp5	T	C	10: 9,808,504	N574S	probably benign	Het
Tbc1d10a	T	C	11: 4,186,948	S54P	possibly damaging	Het
Trim12c	T	C	7: 104,341,262	N336S	unknown	Het
Ubap2	T	C	4: 41,211,710	S351G	probably benign	Het
Unc13c	G	T	9: 73,693,271	A1397E	possibly damaging	Het
Ush1c	G	A	7: 46,205,286	R681*	probably null	Het
Vmn2r57	A	T	7: 41,425,015	C541*	probably null	Het
Vmn2r73	T	C	7: 85,875,748	D64G	possibly damaging	Het
Vmn2r88	A	T	14: 51,418,703	T790S		Het
Zfp568	A	G	7: 29,997,870	T72A	possibly damaging	Het
Zfp950	A	T	19: 61,119,915	Y243*	probably null	Het
Zmym5	A	G	14: 56,798,977	S238P	probably damaging	Het
Zswim5	A	G	4: 116,877,476	E6G	unknown	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7995:Ass1	UTSW	2	31486540	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGAGTGTGTTCCTCAGCTCAC -3'
(R):5'- CTCACTGTCTTCTCACAAAGAGC -3'

Sequencing Primer
(F):5'- GTGTGTTCCTCAGCTCACAAGTG -3'
(R):5'- GTCTTCTCACAAAGAGCTTGAC -3'

Posted On

2019-11-26