Incidental Mutation 'R7811:Fgb'
ID601147
Institutional Source Beutler Lab
Gene Symbol Fgb
Ensembl Gene ENSMUSG00000033831
Gene Namefibrinogen beta chain
Synonyms2510049G14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R7811 (G1)
Quality Score208.009
Status Validated
Chromosome3
Chromosomal Location83040141-83049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83049697 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000039472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048246]
Predicted Effect probably benign
Transcript: ENSMUST00000048246
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039472
Gene: ENSMUSG00000033831
AA Change: D22G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Fib_alpha 80 225 1.28e-64 SMART
FBG 226 477 1.6e-140 SMART
Meta Mutation Damage Score 0.2027 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded preproprotein is proteolytically processed by thrombin to release an N-terminal fibrinopeptide during the conversion of fibrinogen to insoluble fibrin polymer. The encoded protein interacts with the amyloid beta peptide to form fibrin clots of abnormal structure, and may play an important role in Alzheimer's disease. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,577,141 probably null Het
Abca3 A G 17: 24,397,388 T935A probably benign Het
Anxa7 A T 14: 20,460,186 Y399N probably benign Het
Arhgef10l G T 4: 140,515,024 T1030K possibly damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Bms1 T C 6: 118,403,138 D736G probably damaging Het
Bpifb1 T A 2: 154,206,564 probably null Het
Cbx4 A C 11: 119,081,572 C326G probably benign Het
Ccdc188 A G 16: 18,218,450 E94G probably benign Het
Cdh5 A G 8: 104,125,603 T117A possibly damaging Het
Cdk11b A G 4: 155,639,902 T326A unknown Het
Clec5a C T 6: 40,581,933 C73Y probably damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Diaph3 T C 14: 86,981,624 D455G probably damaging Het
Eml2 T A 7: 19,186,122 M117K probably benign Het
Ern1 A T 11: 106,434,868 V112D unknown Het
Eya3 T C 4: 132,711,961 I466T possibly damaging Het
Fbxl6 T C 15: 76,537,285 probably null Het
Ffar1 A G 7: 30,861,377 S32P possibly damaging Het
Fsip2 T C 2: 82,998,453 Y6865H possibly damaging Het
Gbx1 T C 5: 24,505,037 E270G probably damaging Het
Golga4 T C 9: 118,532,575 L207P probably damaging Het
Hnrnpa1 T C 15: 103,241,473 S54P possibly damaging Het
Htr4 A G 18: 62,412,198 E18G possibly damaging Het
Ide A C 19: 37,330,511 L34R Het
Ip6k3 A T 17: 27,157,583 Y51* probably null Het
Keap1 A G 9: 21,237,660 L17P possibly damaging Het
Lrrn2 T C 1: 132,939,201 V668A probably benign Het
Lypd8 A T 11: 58,390,238 T209S possibly damaging Het
Myo10 T C 15: 25,804,524 I1635T probably damaging Het
Myo1e T A 9: 70,327,262 V299E probably damaging Het
Nadk A T 4: 155,576,875 probably benign Het
Nalcn A T 14: 123,298,945 W1231R probably damaging Het
Odf2l A G 3: 145,153,387 T602A probably benign Het
Olfr309 T A 7: 86,306,346 T256S probably damaging Het
Olfr457 T A 6: 42,471,701 E159V probably damaging Het
Pde6c T C 19: 38,140,059 V190A possibly damaging Het
Ppp4r3a C A 12: 101,053,562 R378L probably damaging Het
Pus7l A C 15: 94,540,826 V46G probably damaging Het
Satb2 G A 1: 56,845,721 S466L probably benign Het
Serpina6 A G 12: 103,654,136 M118T probably damaging Het
Slc29a1 T C 17: 45,586,263 R366G probably damaging Het
Slc6a1 T C 6: 114,302,554 F98S probably damaging Het
Spg7 T C 8: 123,097,425 I738T possibly damaging Het
Srcap T C 7: 127,542,049 V1667A probably damaging Het
Stxbp5 T C 10: 9,808,504 N574S probably benign Het
Syne2 A G 12: 75,983,727 probably null Het
Tbc1d10a T C 11: 4,186,948 S54P possibly damaging Het
Trim12c T C 7: 104,341,262 N336S unknown Het
Ubap2 T C 4: 41,211,710 S351G probably benign Het
Unc13c G T 9: 73,693,271 A1397E possibly damaging Het
Ush1c G A 7: 46,205,286 R681* probably null Het
Vmn2r57 A T 7: 41,425,015 C541* probably null Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Vmn2r88 A T 14: 51,418,703 T790S Het
Zfp568 A G 7: 29,997,870 T72A possibly damaging Het
Zfp950 A T 19: 61,119,915 Y243* probably null Het
Zmym5 A G 14: 56,798,977 S238P probably damaging Het
Zswim5 A G 4: 116,877,476 E6G unknown Het
Other mutations in Fgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Fgb APN 3 83043291 missense possibly damaging 0.95
IGL02129:Fgb APN 3 83043418 missense probably benign 0.05
IGL02148:Fgb APN 3 83043287 missense probably damaging 0.99
IGL02286:Fgb APN 3 83043326 missense probably benign
IGL02601:Fgb APN 3 83045060 missense probably benign 0.06
IGL02721:Fgb APN 3 83043367 missense possibly damaging 0.89
R1217:Fgb UTSW 3 83043257 missense probably damaging 0.99
R1424:Fgb UTSW 3 83046763 missense probably damaging 0.99
R1913:Fgb UTSW 3 83044980 missense probably benign 0.03
R1990:Fgb UTSW 3 83044253 nonsense probably null
R2063:Fgb UTSW 3 83049689 missense probably benign 0.09
R2065:Fgb UTSW 3 83049689 missense probably benign 0.09
R2066:Fgb UTSW 3 83049689 missense probably benign 0.09
R2067:Fgb UTSW 3 83049689 missense probably benign 0.09
R2251:Fgb UTSW 3 83043284 missense probably damaging 1.00
R4682:Fgb UTSW 3 83043265 missense probably benign 0.00
R5045:Fgb UTSW 3 83043373 missense probably damaging 1.00
R5573:Fgb UTSW 3 83049677 splice site probably null
R5766:Fgb UTSW 3 83046176 missense probably damaging 1.00
R6103:Fgb UTSW 3 83043863 missense probably benign 0.22
R6315:Fgb UTSW 3 83045055 missense probably benign 0.00
R6469:Fgb UTSW 3 83046142 nonsense probably null
R6664:Fgb UTSW 3 83046759 missense probably damaging 1.00
R6725:Fgb UTSW 3 83043791 missense probably damaging 1.00
R6727:Fgb UTSW 3 83046787 missense possibly damaging 0.62
R6830:Fgb UTSW 3 83045025 missense probably benign 0.07
R7016:Fgb UTSW 3 83046064 missense probably benign 0.01
R7132:Fgb UTSW 3 83046746 nonsense probably null
R7371:Fgb UTSW 3 83046052 missense probably damaging 0.99
R7430:Fgb UTSW 3 83046707 missense probably benign 0.26
R7681:Fgb UTSW 3 83049832 start gained probably benign
R8171:Fgb UTSW 3 83042515 missense probably damaging 0.99
Z1177:Fgb UTSW 3 83045056 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCACCCTGGAGAAACGAAG -3'
(R):5'- GTTCAGCCAACAAGTGAACC -3'

Sequencing Primer
(F):5'- CCTGGAGAAACGAAGGTGAATCATC -3'
(R):5'- GAGGTAACCATTCCTGAAGTCATGC -3'
Posted On2019-11-26