Incidental Mutation 'R7811:Ubap2'
ID601149
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R7811 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41211710 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 351 (S351G)
Ref Sequence ENSEMBL: ENSMUSP00000030143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]
Predicted Effect probably benign
Transcript: ENSMUST00000030143
AA Change: S351G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S351G

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108068
AA Change: S350G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S350G

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135323
AA Change: S84G

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433
AA Change: S84G

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,577,141 probably null Het
Abca3 A G 17: 24,397,388 T935A probably benign Het
Anxa7 A T 14: 20,460,186 Y399N probably benign Het
Arhgef10l G T 4: 140,515,024 T1030K possibly damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Bms1 T C 6: 118,403,138 D736G probably damaging Het
Bpifb1 T A 2: 154,206,564 probably null Het
Cbx4 A C 11: 119,081,572 C326G probably benign Het
Ccdc188 A G 16: 18,218,450 E94G probably benign Het
Cdh5 A G 8: 104,125,603 T117A possibly damaging Het
Cdk11b A G 4: 155,639,902 T326A unknown Het
Clec5a C T 6: 40,581,933 C73Y probably damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Diaph3 T C 14: 86,981,624 D455G probably damaging Het
Eml2 T A 7: 19,186,122 M117K probably benign Het
Ern1 A T 11: 106,434,868 V112D unknown Het
Eya3 T C 4: 132,711,961 I466T possibly damaging Het
Fbxl6 T C 15: 76,537,285 probably null Het
Ffar1 A G 7: 30,861,377 S32P possibly damaging Het
Fgb T C 3: 83,049,697 D22G probably benign Het
Fsip2 T C 2: 82,998,453 Y6865H possibly damaging Het
Gbx1 T C 5: 24,505,037 E270G probably damaging Het
Golga4 T C 9: 118,532,575 L207P probably damaging Het
Hnrnpa1 T C 15: 103,241,473 S54P possibly damaging Het
Htr4 A G 18: 62,412,198 E18G possibly damaging Het
Ide A C 19: 37,330,511 L34R Het
Ip6k3 A T 17: 27,157,583 Y51* probably null Het
Keap1 A G 9: 21,237,660 L17P possibly damaging Het
Lrrn2 T C 1: 132,939,201 V668A probably benign Het
Lypd8 A T 11: 58,390,238 T209S possibly damaging Het
Myo10 T C 15: 25,804,524 I1635T probably damaging Het
Myo1e T A 9: 70,327,262 V299E probably damaging Het
Nadk A T 4: 155,576,875 probably benign Het
Nalcn A T 14: 123,298,945 W1231R probably damaging Het
Odf2l A G 3: 145,153,387 T602A probably benign Het
Olfr309 T A 7: 86,306,346 T256S probably damaging Het
Olfr457 T A 6: 42,471,701 E159V probably damaging Het
Pde6c T C 19: 38,140,059 V190A possibly damaging Het
Ppp4r3a C A 12: 101,053,562 R378L probably damaging Het
Pus7l A C 15: 94,540,826 V46G probably damaging Het
Satb2 G A 1: 56,845,721 S466L probably benign Het
Serpina6 A G 12: 103,654,136 M118T probably damaging Het
Slc29a1 T C 17: 45,586,263 R366G probably damaging Het
Slc6a1 T C 6: 114,302,554 F98S probably damaging Het
Spg7 T C 8: 123,097,425 I738T possibly damaging Het
Srcap T C 7: 127,542,049 V1667A probably damaging Het
Stxbp5 T C 10: 9,808,504 N574S probably benign Het
Syne2 A G 12: 75,983,727 probably null Het
Tbc1d10a T C 11: 4,186,948 S54P possibly damaging Het
Trim12c T C 7: 104,341,262 N336S unknown Het
Unc13c G T 9: 73,693,271 A1397E possibly damaging Het
Ush1c G A 7: 46,205,286 R681* probably null Het
Vmn2r57 A T 7: 41,425,015 C541* probably null Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Vmn2r88 A T 14: 51,418,703 T790S Het
Zfp568 A G 7: 29,997,870 T72A possibly damaging Het
Zfp950 A T 19: 61,119,915 Y243* probably null Het
Zmym5 A G 14: 56,798,977 S238P probably damaging Het
Zswim5 A G 4: 116,877,476 E6G unknown Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 unclassified probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 unclassified probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCAGGAAACTCAGCAG -3'
(R):5'- CTTAGCATTGATCTGGTGGCC -3'

Sequencing Primer
(F):5'- CTACATGGAATCATCAGCTATGTGC -3'
(R):5'- GATCTGGTGGCCTTGCTCC -3'
Posted On2019-11-26