Incidental Mutation 'R7811:Trim12c'
ID601167
Institutional Source Beutler Lab
Gene Symbol Trim12c
Ensembl Gene ENSMUSG00000057143
Gene Nametripartite motif-containing 12C
SynonymsTrim12-2, 9230105E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7811 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104338754-104353362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104341262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 336 (N336S)
Ref Sequence ENSEMBL: ENSMUSP00000060100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106847] [ENSMUST00000130139] [ENSMUST00000180136]
Predicted Effect unknown
Transcript: ENSMUST00000059037
AA Change: N336S
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143
AA Change: N336S

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106847
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130139
AA Change: N336S
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143
AA Change: N336S

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180136
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,577,141 probably null Het
Abca3 A G 17: 24,397,388 T935A probably benign Het
Anxa7 A T 14: 20,460,186 Y399N probably benign Het
Arhgef10l G T 4: 140,515,024 T1030K possibly damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Bms1 T C 6: 118,403,138 D736G probably damaging Het
Bpifb1 T A 2: 154,206,564 probably null Het
Cbx4 A C 11: 119,081,572 C326G probably benign Het
Ccdc188 A G 16: 18,218,450 E94G probably benign Het
Cdh5 A G 8: 104,125,603 T117A possibly damaging Het
Cdk11b A G 4: 155,639,902 T326A unknown Het
Clec5a C T 6: 40,581,933 C73Y probably damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Diaph3 T C 14: 86,981,624 D455G probably damaging Het
Eml2 T A 7: 19,186,122 M117K probably benign Het
Ern1 A T 11: 106,434,868 V112D unknown Het
Eya3 T C 4: 132,711,961 I466T possibly damaging Het
Fbxl6 T C 15: 76,537,285 probably null Het
Ffar1 A G 7: 30,861,377 S32P possibly damaging Het
Fgb T C 3: 83,049,697 D22G probably benign Het
Fsip2 T C 2: 82,998,453 Y6865H possibly damaging Het
Gbx1 T C 5: 24,505,037 E270G probably damaging Het
Golga4 T C 9: 118,532,575 L207P probably damaging Het
Hnrnpa1 T C 15: 103,241,473 S54P possibly damaging Het
Htr4 A G 18: 62,412,198 E18G possibly damaging Het
Ide A C 19: 37,330,511 L34R Het
Ip6k3 A T 17: 27,157,583 Y51* probably null Het
Keap1 A G 9: 21,237,660 L17P possibly damaging Het
Lrrn2 T C 1: 132,939,201 V668A probably benign Het
Lypd8 A T 11: 58,390,238 T209S possibly damaging Het
Myo10 T C 15: 25,804,524 I1635T probably damaging Het
Myo1e T A 9: 70,327,262 V299E probably damaging Het
Nadk A T 4: 155,576,875 probably benign Het
Nalcn A T 14: 123,298,945 W1231R probably damaging Het
Odf2l A G 3: 145,153,387 T602A probably benign Het
Olfr309 T A 7: 86,306,346 T256S probably damaging Het
Olfr457 T A 6: 42,471,701 E159V probably damaging Het
Pde6c T C 19: 38,140,059 V190A possibly damaging Het
Ppp4r3a C A 12: 101,053,562 R378L probably damaging Het
Pus7l A C 15: 94,540,826 V46G probably damaging Het
Satb2 G A 1: 56,845,721 S466L probably benign Het
Serpina6 A G 12: 103,654,136 M118T probably damaging Het
Slc29a1 T C 17: 45,586,263 R366G probably damaging Het
Slc6a1 T C 6: 114,302,554 F98S probably damaging Het
Spg7 T C 8: 123,097,425 I738T possibly damaging Het
Srcap T C 7: 127,542,049 V1667A probably damaging Het
Stxbp5 T C 10: 9,808,504 N574S probably benign Het
Syne2 A G 12: 75,983,727 probably null Het
Tbc1d10a T C 11: 4,186,948 S54P possibly damaging Het
Ubap2 T C 4: 41,211,710 S351G probably benign Het
Unc13c G T 9: 73,693,271 A1397E possibly damaging Het
Ush1c G A 7: 46,205,286 R681* probably null Het
Vmn2r57 A T 7: 41,425,015 C541* probably null Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Vmn2r88 A T 14: 51,418,703 T790S Het
Zfp568 A G 7: 29,997,870 T72A possibly damaging Het
Zfp950 A T 19: 61,119,915 Y243* probably null Het
Zmym5 A G 14: 56,798,977 S238P probably damaging Het
Zswim5 A G 4: 116,877,476 E6G unknown Het
Other mutations in Trim12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Trim12c APN 7 104348215 missense possibly damaging 0.81
IGL01645:Trim12c APN 7 104345054 nonsense probably null
IGL01737:Trim12c APN 7 104348062 missense probably damaging 1.00
IGL02184:Trim12c APN 7 104348223 missense probably benign 0.00
IGL02309:Trim12c APN 7 104344956 missense possibly damaging 0.72
IGL02323:Trim12c APN 7 104348266 missense probably benign 0.00
IGL02656:Trim12c APN 7 104341203 missense probably damaging 1.00
R0127:Trim12c UTSW 7 104340906 splice site probably null
R0554:Trim12c UTSW 7 104344962 missense probably damaging 0.96
R1480:Trim12c UTSW 7 104348244 missense probably damaging 1.00
R1501:Trim12c UTSW 7 104340888 unclassified probably benign
R2058:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R2059:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R3838:Trim12c UTSW 7 104340868 unclassified probably benign
R3870:Trim12c UTSW 7 104348337 missense probably benign 0.00
R4896:Trim12c UTSW 7 104340948 missense probably damaging 0.99
R6288:Trim12c UTSW 7 104346729 missense probably benign 0.19
R6522:Trim12c UTSW 7 104348324 missense probably benign 0.38
R6562:Trim12c UTSW 7 104345134 splice site probably null
R6801:Trim12c UTSW 7 104348130 missense probably damaging 1.00
R7016:Trim12c UTSW 7 104348206 missense
R8076:Trim12c UTSW 7 104340830 missense unknown
R8147:Trim12c UTSW 7 104341958 missense unknown
X0062:Trim12c UTSW 7 104346680 missense probably benign 0.13
Z1176:Trim12c UTSW 7 104341136 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCTGCGAAATAAAGGGTTTC -3'
(R):5'- TCCTGTGACTTCTGCACAAAG -3'

Sequencing Primer
(F):5'- CCTGCGAAATAAAGGGTTTCTTTCAG -3'
(R):5'- GCACAAAGTTCTCTCCAGTGC -3'
Posted On2019-11-26