Incidental Mutation 'R7812:Olfr340'
ID601201
Institutional Source Beutler Lab
Gene Symbol Olfr340
Ensembl Gene ENSMUSG00000094266
Gene Nameolfactory receptor 340
SynonymsGA_x6K02T2NLDC-33147742-33148680, MOR136-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7812 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36452587-36453525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36453278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 231 (I231N)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
Predicted Effect probably benign
Transcript: ENSMUST00000072854
AA Change: I231N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: I231N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Auts2 C T 5: 131,472,446 R43H Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Psg25 A T 7: 18,521,168 N474K possibly damaging Het
Ralgapa1 T A 12: 55,719,628 M838L possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vmn2r59 A T 7: 42,045,772 Y405* probably null Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wdr90 A T 17: 25,852,558 L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Olfr340
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Olfr340 APN 2 36452644 nonsense probably null
IGL01590:Olfr340 APN 2 36452992 missense probably benign 0.39
IGL01614:Olfr340 APN 2 36452624 missense probably benign 0.32
IGL02470:Olfr340 APN 2 36452597 missense probably benign 0.00
IGL02943:Olfr340 APN 2 36453039 missense probably benign 0.05
R0089:Olfr340 UTSW 2 36453095 missense probably benign 0.00
R0600:Olfr340 UTSW 2 36452648 missense probably benign 0.06
R0881:Olfr340 UTSW 2 36453440 missense probably damaging 1.00
R1945:Olfr340 UTSW 2 36453031 missense probably damaging 1.00
R2184:Olfr340 UTSW 2 36453034 missense probably benign
R2196:Olfr340 UTSW 2 36452588 start codon destroyed probably null 1.00
R2419:Olfr340 UTSW 2 36453326 missense probably damaging 1.00
R2859:Olfr340 UTSW 2 36453130 missense probably benign 0.01
R2964:Olfr340 UTSW 2 36452767 missense probably damaging 1.00
R4677:Olfr340 UTSW 2 36453050 missense probably benign 0.00
R4867:Olfr340 UTSW 2 36453199 missense probably benign
R5468:Olfr340 UTSW 2 36453443 missense probably damaging 0.99
R5582:Olfr340 UTSW 2 36453221 missense probably benign 0.03
R6335:Olfr340 UTSW 2 36452722 missense probably benign 0.22
R6415:Olfr340 UTSW 2 36452605 missense probably damaging 0.99
R6664:Olfr340 UTSW 2 36453098 missense probably benign 0.00
R6873:Olfr340 UTSW 2 36453496 missense probably benign 0.00
R7097:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7122:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7199:Olfr340 UTSW 2 36452860 missense probably damaging 1.00
R7275:Olfr340 UTSW 2 36452839 missense probably benign 0.05
R8260:Olfr340 UTSW 2 36452885 missense probably damaging 1.00
Z1088:Olfr340 UTSW 2 36452906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACAGGTATGTGGCCATCTGC -3'
(R):5'- GGATTCAGCATGGGTATGACC -3'

Sequencing Primer
(F):5'- ATGAGTGAGAACCTCTGTGTTC -3'
(R):5'- TGACCATAGTGTACATCATAGCC -3'
Posted On2019-11-26