Incidental Mutation 'R7812:Auts2'
ID601215
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7812 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131472446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 43 (R43H)
Ref Sequence ENSEMBL: ENSMUSP00000124027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect probably damaging
Transcript: ENSMUST00000161374
AA Change: R43H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: R43H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: R43H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187544
AA Change: R252H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: R252H

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr340 T A 2: 36,453,278 I231N probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Psg25 A T 7: 18,521,168 N474K possibly damaging Het
Ralgapa1 T A 12: 55,719,628 M838L possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vmn2r59 A T 7: 42,045,772 Y405* probably null Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wdr90 A T 17: 25,852,558 L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACATTTCTGCCTGGGGTAC -3'
(R):5'- TCGCATAACACTAGGTCCTTATAG -3'

Sequencing Primer
(F):5'- ACCATGGGAGGTGCTGG -3'
(R):5'- ATACATGCTGGCGTGTACAC -3'
Posted On2019-11-26