Incidental Mutation 'R7812:Psg25'
ID601217
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Namepregnancy-specific glycoprotein 25
Synonymscea13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7812 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18519702-18532269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18521168 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 474 (N474K)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094795
AA Change: N474K

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: N474K

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Auts2 C T 5: 131,472,446 R43H Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr340 T A 2: 36,453,278 I231N probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Ralgapa1 T A 12: 55,719,628 M838L possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vmn2r59 A T 7: 42,045,772 Y405* probably null Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wdr90 A T 17: 25,852,558 L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18526181 splice site probably benign
IGL00508:Psg25 APN 7 18529731 missense probably benign
IGL01154:Psg25 APN 7 18524699 missense probably benign 0.01
IGL01388:Psg25 APN 7 18529665 missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18529727 missense probably damaging 1.00
IGL02261:Psg25 APN 7 18521343 missense probably benign 0.09
IGL02309:Psg25 APN 7 18526424 missense probably damaging 0.98
IGL02803:Psg25 APN 7 18526287 missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18529774 missense probably benign 0.01
R0711:Psg25 UTSW 7 18529560 nonsense probably null
R1458:Psg25 UTSW 7 18529587 missense probably damaging 1.00
R1598:Psg25 UTSW 7 18532003 nonsense probably null
R2064:Psg25 UTSW 7 18521253 missense probably damaging 0.96
R2066:Psg25 UTSW 7 18529562 missense probably damaging 1.00
R4485:Psg25 UTSW 7 18526278 missense probably damaging 1.00
R4499:Psg25 UTSW 7 18524891 missense possibly damaging 0.89
R4514:Psg25 UTSW 7 18529608 nonsense probably null
R4547:Psg25 UTSW 7 18524704 missense probably damaging 1.00
R4604:Psg25 UTSW 7 18529803 missense probably benign 0.05
R4886:Psg25 UTSW 7 18524913 missense probably benign 0.00
R5121:Psg25 UTSW 7 18526536 missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5267:Psg25 UTSW 7 18524786 missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5425:Psg25 UTSW 7 18524784 nonsense probably null
R5749:Psg25 UTSW 7 18524851 missense probably damaging 1.00
R6050:Psg25 UTSW 7 18526478 missense probably benign 0.37
R6862:Psg25 UTSW 7 18521398 missense probably benign 0.03
R6962:Psg25 UTSW 7 18529754 missense probably damaging 1.00
R7238:Psg25 UTSW 7 18532202 start gained probably benign
R7782:Psg25 UTSW 7 18521302 missense probably benign 0.15
Z1088:Psg25 UTSW 7 18529591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGCAACAATAGTAAGC -3'
(R):5'- CCGTTGGCTCTTCAACAATCAG -3'

Sequencing Primer
(F):5'- CCAAGGGAGTATGCTTGAATCTCAC -3'
(R):5'- TGGCTCTTCAACAATCAGAATCTGC -3'
Posted On2019-11-26