Incidental Mutation 'R7812:Vmn2r59'
ID601219
Institutional Source Beutler Lab
Gene Symbol Vmn2r59
Ensembl Gene ENSMUSG00000092032
Gene Namevomeronasal 2, receptor 59
SynonymsEG628444
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7812 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42011792-42058981 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 42045772 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 405 (Y405*)
Ref Sequence ENSEMBL: ENSMUSP00000131856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168489]
Predicted Effect probably null
Transcript: ENSMUST00000168489
AA Change: Y405*
SMART Domains Protein: ENSMUSP00000131856
Gene: ENSMUSG00000092032
AA Change: Y405*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-44 PFAM
Pfam:NCD3G 514 567 4.3e-23 PFAM
Pfam:7tm_3 600 835 5.4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Auts2 C T 5: 131,472,446 R43H Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr340 T A 2: 36,453,278 I231N probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Psg25 A T 7: 18,521,168 N474K possibly damaging Het
Ralgapa1 T A 12: 55,719,628 M838L possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wdr90 A T 17: 25,852,558 L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Vmn2r59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r59 APN 7 42012064 missense possibly damaging 0.91
IGL01432:Vmn2r59 APN 7 42012559 missense possibly damaging 0.82
IGL02119:Vmn2r59 APN 7 42046169 missense probably benign 0.36
IGL02216:Vmn2r59 APN 7 42012393 missense probably damaging 1.00
IGL02327:Vmn2r59 APN 7 42012231 missense probably benign
IGL03346:Vmn2r59 APN 7 42043829 missense probably benign 0.00
IGL03411:Vmn2r59 APN 7 42058916 missense probably benign 0.43
IGL03412:Vmn2r59 APN 7 42012438 missense probably benign
PIT4366001:Vmn2r59 UTSW 7 42045781 missense possibly damaging 0.91
R0068:Vmn2r59 UTSW 7 42046301 missense probably damaging 0.99
R0094:Vmn2r59 UTSW 7 42012298 missense probably benign 0.07
R0179:Vmn2r59 UTSW 7 42047008 nonsense probably null
R0370:Vmn2r59 UTSW 7 42012726 missense probably benign 0.23
R0412:Vmn2r59 UTSW 7 42046492 splice site probably benign
R0465:Vmn2r59 UTSW 7 42046908 missense probably benign
R0487:Vmn2r59 UTSW 7 42047104 nonsense probably null
R0576:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R0632:Vmn2r59 UTSW 7 42058884 missense probably damaging 1.00
R1356:Vmn2r59 UTSW 7 42011794 makesense probably null
R1387:Vmn2r59 UTSW 7 42046097 missense probably damaging 1.00
R1388:Vmn2r59 UTSW 7 42045709 missense probably benign 0.01
R1435:Vmn2r59 UTSW 7 42046205 missense possibly damaging 0.50
R1750:Vmn2r59 UTSW 7 42045827 missense possibly damaging 0.50
R2020:Vmn2r59 UTSW 7 42043779 missense probably damaging 1.00
R2249:Vmn2r59 UTSW 7 42058902 missense probably benign 0.00
R2256:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2257:Vmn2r59 UTSW 7 42012245 nonsense probably null
R2441:Vmn2r59 UTSW 7 42046146 missense probably benign 0.00
R2511:Vmn2r59 UTSW 7 42043766 missense probably damaging 1.00
R2860:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R2861:Vmn2r59 UTSW 7 42047003 missense possibly damaging 0.79
R3690:Vmn2r59 UTSW 7 42011946 missense possibly damaging 0.77
R3912:Vmn2r59 UTSW 7 42046320 missense probably benign 0.00
R4167:Vmn2r59 UTSW 7 42021308 intron probably benign
R4357:Vmn2r59 UTSW 7 42012220 missense probably damaging 1.00
R4445:Vmn2r59 UTSW 7 42042450 missense probably damaging 1.00
R4542:Vmn2r59 UTSW 7 42046073 missense possibly damaging 0.93
R4587:Vmn2r59 UTSW 7 42046224 missense probably benign 0.00
R4616:Vmn2r59 UTSW 7 42012438 missense probably benign
R4653:Vmn2r59 UTSW 7 42043804 missense probably benign 0.19
R4703:Vmn2r59 UTSW 7 42012262 missense probably benign 0.01
R4895:Vmn2r59 UTSW 7 42045794 missense probably damaging 0.98
R4910:Vmn2r59 UTSW 7 42043653 missense probably benign
R5045:Vmn2r59 UTSW 7 42046072 missense possibly damaging 0.93
R5105:Vmn2r59 UTSW 7 42047105 missense probably benign 0.01
R5153:Vmn2r59 UTSW 7 42042410 critical splice donor site probably null
R5566:Vmn2r59 UTSW 7 42046823 missense possibly damaging 0.92
R5586:Vmn2r59 UTSW 7 42045681 missense probably benign 0.12
R5606:Vmn2r59 UTSW 7 42045894 missense probably benign 0.27
R5616:Vmn2r59 UTSW 7 42058767 splice site probably null
R5625:Vmn2r59 UTSW 7 42046460 missense probably benign 0.03
R5696:Vmn2r59 UTSW 7 42046044 missense probably benign 0.00
R5982:Vmn2r59 UTSW 7 42046067 missense probably benign 0.00
R6106:Vmn2r59 UTSW 7 42012325 nonsense probably null
R6196:Vmn2r59 UTSW 7 42012255 missense probably benign 0.36
R6228:Vmn2r59 UTSW 7 42042411 critical splice donor site probably null
R6590:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6625:Vmn2r59 UTSW 7 42043753 missense probably benign 0.02
R6690:Vmn2r59 UTSW 7 42046466 missense probably damaging 1.00
R6768:Vmn2r59 UTSW 7 42011968 missense probably benign 0.17
R6830:Vmn2r59 UTSW 7 42043747 missense probably benign 0.10
R6859:Vmn2r59 UTSW 7 42043853 missense probably damaging 1.00
R7034:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7036:Vmn2r59 UTSW 7 42046220 missense probably benign 0.03
R7145:Vmn2r59 UTSW 7 42045764 missense probably damaging 1.00
R7556:Vmn2r59 UTSW 7 42045809 missense probably damaging 1.00
R7733:Vmn2r59 UTSW 7 42012019 missense probably benign 0.17
R7770:Vmn2r59 UTSW 7 42058912 missense probably damaging 1.00
R7867:Vmn2r59 UTSW 7 42012283 missense probably damaging 1.00
R7950:Vmn2r59 UTSW 7 42012283 missense probably damaging 1.00
R7999:Vmn2r59 UTSW 7 42046832
X0025:Vmn2r59 UTSW 7 42045941 missense probably damaging 1.00
Z1088:Vmn2r59 UTSW 7 42012414 missense possibly damaging 0.85
Z1176:Vmn2r59 UTSW 7 42042517
Predicted Primers PCR Primer
(F):5'- CTCCATTGCTTATTGACAGCATAG -3'
(R):5'- CCACCGTGAAGAGATGGTTG -3'

Sequencing Primer
(F):5'- GACAGCATAGTCTAAAACATGTGATG -3'
(R):5'- TTTGTCCAAACAGTTAATCCCTAC -3'
Posted On2019-11-26