Incidental Mutation 'R7812:Shprh'
ID 601236
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 045867-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11027735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 114 (Q114R)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: Q114R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: Q114R

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: Q114R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: Q114R

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: Q114R

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: Q114R

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: Q114R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: Q114R

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,165,141 (GRCm39) C411F probably damaging Het
Abhd17c G T 7: 83,800,624 (GRCm39) Y143* probably null Het
Acad11 T G 9: 103,972,747 (GRCm39) L480R probably benign Het
Acad8 A T 9: 26,890,476 (GRCm39) N277K probably damaging Het
Adcy10 A G 1: 165,342,938 (GRCm39) Y268C probably damaging Het
Adm2 A T 15: 89,208,367 (GRCm39) R102S possibly damaging Het
Ambra1 A T 2: 91,596,911 (GRCm39) M1L probably benign Het
Angpt2 T C 8: 18,742,161 (GRCm39) N465S probably benign Het
Arhgap17 T C 7: 122,879,290 (GRCm39) I820M unknown Het
Atf7ip G A 6: 136,580,415 (GRCm39) R1113Q probably damaging Het
Atp5pb A G 3: 105,851,157 (GRCm39) V180A probably benign Het
Auts2 C T 5: 131,501,284 (GRCm39) R43H Het
Cacna1g A T 11: 94,334,880 (GRCm39) I809N probably benign Het
Cand1 A T 10: 119,053,864 (GRCm39) M158K probably benign Het
Cars1 T A 7: 143,123,784 (GRCm39) I500F probably damaging Het
Ccdc18 T A 5: 108,328,699 (GRCm39) M706K probably benign Het
Ccdc180 G A 4: 45,906,952 (GRCm39) probably null Het
Ces1f A G 8: 93,984,938 (GRCm39) V463A probably benign Het
Cndp1 G T 18: 84,655,994 (GRCm39) D58E probably benign Het
Csnk2b A T 17: 35,339,431 (GRCm39) F21Y probably benign Het
Dgkg C G 16: 22,385,165 (GRCm39) R447T probably damaging Het
Dnajc12 A G 10: 63,242,905 (GRCm39) D141G probably benign Het
Edar A G 10: 58,465,926 (GRCm39) V4A probably benign Het
Elf1 A G 14: 79,802,998 (GRCm39) D117G probably damaging Het
Fam124b T C 1: 80,191,351 (GRCm39) T11A probably damaging Het
Fgl2 C A 5: 21,577,896 (GRCm39) T61K probably benign Het
Furin T C 7: 80,045,722 (GRCm39) N218S possibly damaging Het
Gcn1 T A 5: 115,731,751 (GRCm39) H955Q possibly damaging Het
Gucy2e A G 11: 69,117,069 (GRCm39) I784T probably damaging Het
Ice1 T A 13: 70,751,124 (GRCm39) Q1654L possibly damaging Het
Klhl28 T C 12: 64,990,363 (GRCm39) N526S possibly damaging Het
Ldlrad4 C A 18: 68,239,742 (GRCm39) P54Q probably benign Het
Lsm14a A G 7: 34,088,301 (GRCm39) probably benign Het
Mdga1 A G 17: 30,062,115 (GRCm39) V438A probably benign Het
Mrto4 A G 4: 139,075,278 (GRCm39) V175A possibly damaging Het
Nav2 T G 7: 49,246,921 (GRCm39) S2149A probably benign Het
Nr4a2 A G 2: 57,002,430 (GRCm39) Y8H probably damaging Het
Or10q12 T C 19: 13,746,380 (GRCm39) F225L probably benign Het
Or1j12 T A 2: 36,343,290 (GRCm39) I231N probably benign Het
Or1j18 A T 2: 36,624,737 (GRCm39) M135L probably benign Het
Or52e4 T C 7: 104,705,894 (GRCm39) L147P possibly damaging Het
Oxr1 T A 15: 41,615,138 (GRCm39) M1K probably null Het
Pbx3 T C 2: 34,114,478 (GRCm39) Y152C probably damaging Het
Pcdhb13 T A 18: 37,575,645 (GRCm39) C8S probably benign Het
Polr1c G A 17: 46,557,053 (GRCm39) R77W probably damaging Het
Psg25 A T 7: 18,255,093 (GRCm39) N474K possibly damaging Het
Ralgapa1 T A 12: 55,766,413 (GRCm39) M838L possibly damaging Het
Ranbp2 A G 10: 58,303,224 (GRCm39) T799A probably benign Het
Sbf2 C T 7: 110,049,170 (GRCm39) V265I possibly damaging Het
Scarf2 G A 16: 17,621,692 (GRCm39) G381R probably damaging Het
Sipa1l2 A C 8: 126,218,334 (GRCm39) D334E probably damaging Het
Slc26a4 T A 12: 31,594,449 (GRCm39) I300F probably damaging Het
Sox7 C T 14: 64,185,681 (GRCm39) T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
St6galnac1 G T 11: 116,659,927 (GRCm39) H129N probably benign Het
Stxbp4 A G 11: 90,485,654 (GRCm39) L231P probably damaging Het
Syngap1 A C 17: 27,160,478 (GRCm39) Y18S probably benign Het
Tenm3 T C 8: 48,729,335 (GRCm39) Y1557C probably benign Het
Trim44 G T 2: 102,230,489 (GRCm39) P181T possibly damaging Het
Trp53i13 A T 11: 77,399,666 (GRCm39) V221D possibly damaging Het
Trpm7 A G 2: 126,641,236 (GRCm39) S1554P probably damaging Het
Vcl A G 14: 21,045,158 (GRCm39) N288D probably benign Het
Vmn2r59 A T 7: 41,695,196 (GRCm39) Y405* probably null Het
Vps35 T C 8: 86,010,818 (GRCm39) D175G probably benign Het
Wdr90 A T 17: 26,071,532 (GRCm39) L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 (GRCm39) T517I probably damaging Het
Zfp462 T G 4: 55,008,509 (GRCm39) F158L probably benign Het
Zfp703 T A 8: 27,469,906 (GRCm39) H523Q probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCATCGATGAAGGCCCTCC -3'
(R):5'- TCTGTAGCCAGGCCAAATC -3'

Sequencing Primer
(F):5'- ATGAAGGCCCTCCTGAGAGTG -3'
(R):5'- CATGTCACTACTGAAGGAGGATTCC -3'
Posted On 2019-11-26