Incidental Mutation 'R7812:Ralgapa1'
ID 601247
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 045867-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.823) question?
Stock # R7812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 55602896-55821167 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55719628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 838 (M838L)
Ref Sequence ENSEMBL: ENSMUSP00000082503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
AlphaFold Q6GYP7
Predicted Effect possibly damaging
Transcript: ENSMUST00000085385
AA Change: M838L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: M838L

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110687
AA Change: M838L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: M838L

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219432
AA Change: M885L

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220367
AA Change: M838L

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000226244
AA Change: M1294L

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Auts2 C T 5: 131,472,446 R43H Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr340 T A 2: 36,453,278 I231N probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Psg25 A T 7: 18,521,168 N474K possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vmn2r59 A T 7: 42,045,772 Y405* probably null Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wdr90 A T 17: 25,852,558 L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
wickedwarlock UTSW 12 55777292 missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 splice site probably null
R2203:Ralgapa1 UTSW 12 55612800 splice site probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55782846 missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55722914 missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55741523 missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55659062 missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55676518 missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55739413 missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55738217 missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55738316 missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55702560 missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55820761 missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55677006 missense probably benign
R9011:Ralgapa1 UTSW 12 55605529 intron probably benign
R9089:Ralgapa1 UTSW 12 55676566 missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55735096 missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55709058 missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
R9446:Ralgapa1 UTSW 12 55708023 missense probably damaging 0.97
R9684:Ralgapa1 UTSW 12 55612700 missense possibly damaging 0.63
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTGTGAAGGCTGATGGAC -3'
(R):5'- CAAATACTTGATATGGCAGAGGTAC -3'

Sequencing Primer
(F):5'- ATGTGACCTCTACATGCATGCAG -3'
(R):5'- GGCAGAGGTACTTTATTTTGGATTAC -3'
Posted On 2019-11-26