Incidental Mutation 'R7812:Ice1'
ID 601249
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 045867-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70751124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1654 (Q1654L)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: Q1654L

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: Q1654L

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,165,141 (GRCm39) C411F probably damaging Het
Abhd17c G T 7: 83,800,624 (GRCm39) Y143* probably null Het
Acad11 T G 9: 103,972,747 (GRCm39) L480R probably benign Het
Acad8 A T 9: 26,890,476 (GRCm39) N277K probably damaging Het
Adcy10 A G 1: 165,342,938 (GRCm39) Y268C probably damaging Het
Adm2 A T 15: 89,208,367 (GRCm39) R102S possibly damaging Het
Ambra1 A T 2: 91,596,911 (GRCm39) M1L probably benign Het
Angpt2 T C 8: 18,742,161 (GRCm39) N465S probably benign Het
Arhgap17 T C 7: 122,879,290 (GRCm39) I820M unknown Het
Atf7ip G A 6: 136,580,415 (GRCm39) R1113Q probably damaging Het
Atp5pb A G 3: 105,851,157 (GRCm39) V180A probably benign Het
Auts2 C T 5: 131,501,284 (GRCm39) R43H Het
Cacna1g A T 11: 94,334,880 (GRCm39) I809N probably benign Het
Cand1 A T 10: 119,053,864 (GRCm39) M158K probably benign Het
Cars1 T A 7: 143,123,784 (GRCm39) I500F probably damaging Het
Ccdc18 T A 5: 108,328,699 (GRCm39) M706K probably benign Het
Ccdc180 G A 4: 45,906,952 (GRCm39) probably null Het
Ces1f A G 8: 93,984,938 (GRCm39) V463A probably benign Het
Cndp1 G T 18: 84,655,994 (GRCm39) D58E probably benign Het
Csnk2b A T 17: 35,339,431 (GRCm39) F21Y probably benign Het
Dgkg C G 16: 22,385,165 (GRCm39) R447T probably damaging Het
Dnajc12 A G 10: 63,242,905 (GRCm39) D141G probably benign Het
Edar A G 10: 58,465,926 (GRCm39) V4A probably benign Het
Elf1 A G 14: 79,802,998 (GRCm39) D117G probably damaging Het
Fam124b T C 1: 80,191,351 (GRCm39) T11A probably damaging Het
Fgl2 C A 5: 21,577,896 (GRCm39) T61K probably benign Het
Furin T C 7: 80,045,722 (GRCm39) N218S possibly damaging Het
Gcn1 T A 5: 115,731,751 (GRCm39) H955Q possibly damaging Het
Gucy2e A G 11: 69,117,069 (GRCm39) I784T probably damaging Het
Klhl28 T C 12: 64,990,363 (GRCm39) N526S possibly damaging Het
Ldlrad4 C A 18: 68,239,742 (GRCm39) P54Q probably benign Het
Lsm14a A G 7: 34,088,301 (GRCm39) probably benign Het
Mdga1 A G 17: 30,062,115 (GRCm39) V438A probably benign Het
Mrto4 A G 4: 139,075,278 (GRCm39) V175A possibly damaging Het
Nav2 T G 7: 49,246,921 (GRCm39) S2149A probably benign Het
Nr4a2 A G 2: 57,002,430 (GRCm39) Y8H probably damaging Het
Or10q12 T C 19: 13,746,380 (GRCm39) F225L probably benign Het
Or1j12 T A 2: 36,343,290 (GRCm39) I231N probably benign Het
Or1j18 A T 2: 36,624,737 (GRCm39) M135L probably benign Het
Or52e4 T C 7: 104,705,894 (GRCm39) L147P possibly damaging Het
Oxr1 T A 15: 41,615,138 (GRCm39) M1K probably null Het
Pbx3 T C 2: 34,114,478 (GRCm39) Y152C probably damaging Het
Pcdhb13 T A 18: 37,575,645 (GRCm39) C8S probably benign Het
Polr1c G A 17: 46,557,053 (GRCm39) R77W probably damaging Het
Psg25 A T 7: 18,255,093 (GRCm39) N474K possibly damaging Het
Ralgapa1 T A 12: 55,766,413 (GRCm39) M838L possibly damaging Het
Ranbp2 A G 10: 58,303,224 (GRCm39) T799A probably benign Het
Sbf2 C T 7: 110,049,170 (GRCm39) V265I possibly damaging Het
Scarf2 G A 16: 17,621,692 (GRCm39) G381R probably damaging Het
Shprh A G 10: 11,027,735 (GRCm39) Q114R probably benign Het
Sipa1l2 A C 8: 126,218,334 (GRCm39) D334E probably damaging Het
Slc26a4 T A 12: 31,594,449 (GRCm39) I300F probably damaging Het
Sox7 C T 14: 64,185,681 (GRCm39) T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
St6galnac1 G T 11: 116,659,927 (GRCm39) H129N probably benign Het
Stxbp4 A G 11: 90,485,654 (GRCm39) L231P probably damaging Het
Syngap1 A C 17: 27,160,478 (GRCm39) Y18S probably benign Het
Tenm3 T C 8: 48,729,335 (GRCm39) Y1557C probably benign Het
Trim44 G T 2: 102,230,489 (GRCm39) P181T possibly damaging Het
Trp53i13 A T 11: 77,399,666 (GRCm39) V221D possibly damaging Het
Trpm7 A G 2: 126,641,236 (GRCm39) S1554P probably damaging Het
Vcl A G 14: 21,045,158 (GRCm39) N288D probably benign Het
Vmn2r59 A T 7: 41,695,196 (GRCm39) Y405* probably null Het
Vps35 T C 8: 86,010,818 (GRCm39) D175G probably benign Het
Wdr90 A T 17: 26,071,532 (GRCm39) L949Q probably damaging Het
Wwp1 G A 4: 19,639,991 (GRCm39) T517I probably damaging Het
Zfp462 T G 4: 55,008,509 (GRCm39) F158L probably benign Het
Zfp703 T A 8: 27,469,906 (GRCm39) H523Q probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAATTCTCCTGCTGCG -3'
(R):5'- CTCCTGACACTCTGAGCAAG -3'

Sequencing Primer
(F):5'- TTGGTGTAGCAGCACAGA -3'
(R):5'- TGACACTCTGAGCAAGATCCGG -3'
Posted On 2019-11-26