Incidental Mutation 'R7812:Wdr90'
ID601257
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7812 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25852558 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 949 (L949Q)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably damaging
Transcript: ENSMUST00000079461
AA Change: L949Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: L949Q

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176678
Predicted Effect probably damaging
Transcript: ENSMUST00000176923
AA Change: L931Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: L931Q

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,858 C411F probably damaging Het
Abhd17c G T 7: 84,151,416 Y143* probably null Het
Acad11 T G 9: 104,095,548 L480R probably benign Het
Acad8 A T 9: 26,979,180 N277K probably damaging Het
Adcy10 A G 1: 165,515,369 Y268C probably damaging Het
Adm2 A T 15: 89,324,164 R102S possibly damaging Het
Ambra1 A T 2: 91,766,566 M1L probably benign Het
Angpt2 T C 8: 18,692,145 N465S probably benign Het
Arhgap17 T C 7: 123,280,067 I820M unknown Het
Atf7ip G A 6: 136,603,417 R1113Q probably damaging Het
Atp5f1 A G 3: 105,943,841 V180A probably benign Het
Auts2 C T 5: 131,472,446 R43H Het
Cacna1g A T 11: 94,444,054 I809N probably benign Het
Cand1 A T 10: 119,217,959 M158K probably benign Het
Cars T A 7: 143,570,047 I500F probably damaging Het
Ccdc18 T A 5: 108,180,833 M706K probably benign Het
Ccdc180 G A 4: 45,906,952 probably null Het
Ces1f A G 8: 93,258,310 V463A probably benign Het
Cndp1 G T 18: 84,637,869 D58E probably benign Het
Csnk2b A T 17: 35,120,455 F21Y probably benign Het
Dgkg C G 16: 22,566,415 R447T probably damaging Het
Dnajc12 A G 10: 63,407,126 D141G probably benign Het
Edar A G 10: 58,630,104 V4A probably benign Het
Elf1 A G 14: 79,565,558 D117G probably damaging Het
Fam124b T C 1: 80,213,634 T11A probably damaging Het
Fgl2 C A 5: 21,372,898 T61K probably benign Het
Furin T C 7: 80,395,974 N218S possibly damaging Het
Gcn1l1 T A 5: 115,593,692 H955Q possibly damaging Het
Gucy2e A G 11: 69,226,243 I784T probably damaging Het
Ice1 T A 13: 70,603,005 Q1654L possibly damaging Het
Klhl28 T C 12: 64,943,589 N526S possibly damaging Het
Ldlrad4 C A 18: 68,106,671 P54Q probably benign Het
Lsm14a A G 7: 34,388,876 probably benign Het
Mdga1 A G 17: 29,843,141 V438A probably benign Het
Mrto4 A G 4: 139,347,967 V175A possibly damaging Het
Nav2 T G 7: 49,597,173 S2149A probably benign Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr1495 T C 19: 13,769,016 F225L probably benign Het
Olfr340 T A 2: 36,453,278 I231N probably benign Het
Olfr347 A T 2: 36,734,725 M135L probably benign Het
Olfr677 T C 7: 105,056,687 L147P possibly damaging Het
Oxr1 T A 15: 41,751,742 M1K probably null Het
Pbx3 T C 2: 34,224,466 Y152C probably damaging Het
Pcdhb13 T A 18: 37,442,592 C8S probably benign Het
Polr1c G A 17: 46,246,127 R77W probably damaging Het
Psg25 A T 7: 18,521,168 N474K possibly damaging Het
Ralgapa1 T A 12: 55,719,628 M838L possibly damaging Het
Ranbp2 A G 10: 58,467,402 T799A probably benign Het
Sbf2 C T 7: 110,449,963 V265I possibly damaging Het
Scarf2 G A 16: 17,803,828 G381R probably damaging Het
Shprh A G 10: 11,151,991 Q114R probably benign Het
Sipa1l2 A C 8: 125,491,595 D334E probably damaging Het
Slc26a4 T A 12: 31,544,450 I300F probably damaging Het
Sox7 C T 14: 63,948,232 T239I probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
St6galnac1 G T 11: 116,769,101 H129N probably benign Het
Stxbp4 A G 11: 90,594,828 L231P probably damaging Het
Syngap1 A C 17: 26,941,504 Y18S probably benign Het
Tenm3 T C 8: 48,276,300 Y1557C probably benign Het
Trim44 G T 2: 102,400,144 P181T possibly damaging Het
Trp53i13 A T 11: 77,508,840 V221D possibly damaging Het
Trpm7 A G 2: 126,799,316 S1554P probably damaging Het
Vcl A G 14: 20,995,090 N288D probably benign Het
Vmn2r59 A T 7: 42,045,772 Y405* probably null Het
Vps35 T C 8: 85,284,189 D175G probably benign Het
Wwp1 G A 4: 19,639,991 T517I probably damaging Het
Zfp462 T G 4: 55,008,509 F158L probably benign Het
Zfp703 T A 8: 26,979,878 H523Q probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
R8260:Wdr90 UTSW 17 25845167 missense probably damaging 1.00
R8315:Wdr90 UTSW 17 25845425 missense probably benign 0.21
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGCCCCTTTGTGGTAGAG -3'
(R):5'- CCTATCCCCGATAATGAAGGTC -3'

Sequencing Primer
(F):5'- ACTGCCTGTAGTGCCCTGAC -3'
(R):5'- ATCCCCGATAATGAAGGTCTTGGC -3'
Posted On2019-11-26