Incidental Mutation 'R7813:Cadm3'
ID601270
Institutional Source Beutler Lab
Gene Symbol Cadm3
Ensembl Gene ENSMUSG00000005338
Gene Namecell adhesion molecule 3
SynonymsSynCAM3, Tsll1, Igsf4b, BIgR, Necl-1, Necl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7813 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173333258-173367695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 173344389 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 206 (V206L)
Ref Sequence ENSEMBL: ENSMUSP00000106851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000111220]
Predicted Effect probably benign
Transcript: ENSMUST00000005470
AA Change: V240L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338
AA Change: V240L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111220
AA Change: V206L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338
AA Change: V206L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed myelination. Other mice with ubiquitous conditional deletion of the gene do not display neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,224,900 R423K probably benign Het
Acot7 T C 4: 152,223,118 S170P probably damaging Het
Arhgap40 A G 2: 158,538,700 Q341R probably benign Het
Arhgef28 T C 13: 97,945,681 E1206G possibly damaging Het
Arpp21 T A 9: 112,179,065 K122N probably damaging Het
Arsi T C 18: 60,916,654 L203P possibly damaging Het
C1rb A T 6: 124,580,529 I542F probably benign Het
Card11 T C 5: 140,899,664 D380G probably damaging Het
Ccdc42 A T 11: 68,597,708 Q164L probably benign Het
Ccnd1 A G 7: 144,937,885 probably null Het
Cep120 T C 18: 53,738,506 D98G probably damaging Het
Chrd A G 16: 20,735,405 T336A probably benign Het
Clca2 C A 3: 145,084,965 A449S probably benign Het
Dnah7a A G 1: 53,618,086 F844L probably benign Het
Fbxo11 T A 17: 88,000,817 I480F Het
Fcrl5 A G 3: 87,443,623 T147A probably benign Het
Gm15130 T A 2: 111,138,975 I133F Het
Gpr155 C T 2: 73,381,985 W98* probably null Het
Hspa4 A G 11: 53,272,036 S408P probably damaging Het
Il12rb2 G A 6: 67,356,651 R215C possibly damaging Het
Itga5 T A 15: 103,357,314 probably null Het
Kcnip3 T A 2: 127,481,783 probably null Het
Krt12 A G 11: 99,418,483 probably null Het
March3 A T 18: 56,783,091 S177R probably benign Het
Minpp1 T G 19: 32,491,403 F229V probably damaging Het
Muc2 G A 7: 141,696,300 probably null Het
Myh10 A G 11: 68,785,909 T906A probably benign Het
Myh13 A G 11: 67,327,230 D43G probably benign Het
Nacad C T 11: 6,599,071 D1327N probably benign Het
Nbeal1 A T 1: 60,291,889 Y2219F probably damaging Het
Nckap5 A G 1: 126,025,426 S1130P probably benign Het
Pfkfb3 T C 2: 11,481,908 N415S probably benign Het
Plxdc2 A G 2: 16,660,867 I293V possibly damaging Het
Prpf38a A T 4: 108,579,080 I12N probably damaging Het
Ptprt C T 2: 161,530,493 V1420M probably damaging Het
Qars A G 9: 108,509,471 D161G probably damaging Het
Scaf8 T A 17: 3,197,274 D957E probably damaging Het
Scn7a T C 2: 66,676,345 Y1400C probably damaging Het
Sis T C 3: 72,925,468 I999V probably benign Het
Sorcs2 A T 5: 36,024,614 L1054H probably damaging Het
Sptbn1 C T 11: 30,138,455 A906T probably damaging Het
Srd5a2 A G 17: 74,024,546 F152S probably benign Het
Stkld1 T A 2: 26,945,876 L241* probably null Het
Strip2 A T 6: 29,923,913 probably null Het
Tcaf1 A C 6: 42,673,429 Y905* probably null Het
Tet2 T C 3: 133,473,643 I1254V probably benign Het
Tiam2 A T 17: 3,437,247 N681I probably damaging Het
Trappc6a A G 7: 19,514,199 probably null Het
Trav12-2 A T 14: 53,616,766 K66* probably null Het
Ttn T A 2: 76,767,497 I19691F probably damaging Het
Tubgcp5 A T 7: 55,800,696 Q185L possibly damaging Het
Vmn1r44 A T 6: 89,892,210 probably benign Het
Vps13a T C 19: 16,651,456 D2717G possibly damaging Het
Vps13d A T 4: 145,178,063 Y133* probably null Het
Zer1 T C 2: 30,110,373 D265G probably damaging Het
Zfp710 A G 7: 80,081,111 D12G possibly damaging Het
Zfp819 T C 7: 43,616,767 S225P probably benign Het
Other mutations in Cadm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Cadm3 APN 1 173341108 missense possibly damaging 0.66
IGL01989:Cadm3 APN 1 173338011 unclassified probably benign
IGL02224:Cadm3 APN 1 173338061 missense possibly damaging 0.51
IGL03105:Cadm3 APN 1 173345016 missense probably damaging 0.96
R0243:Cadm3 UTSW 1 173346573 unclassified probably benign
R0583:Cadm3 UTSW 1 173341171 missense probably benign 0.00
R0689:Cadm3 UTSW 1 173344452 missense possibly damaging 0.95
R2060:Cadm3 UTSW 1 173344402 missense probably damaging 1.00
R2859:Cadm3 UTSW 1 173346545 missense possibly damaging 0.90
R3764:Cadm3 UTSW 1 173346497 missense probably damaging 1.00
R4077:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4079:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4521:Cadm3 UTSW 1 173345063 splice site probably null
R4670:Cadm3 UTSW 1 173346446 missense probably damaging 1.00
R4965:Cadm3 UTSW 1 173337097 missense probably damaging 1.00
R5267:Cadm3 UTSW 1 173337102 missense probably damaging 1.00
R6273:Cadm3 UTSW 1 173349124 unclassified probably benign
R6315:Cadm3 UTSW 1 173344352 missense probably benign 0.16
R6342:Cadm3 UTSW 1 173341108 missense possibly damaging 0.66
R6544:Cadm3 UTSW 1 173367411 critical splice donor site probably null
R6565:Cadm3 UTSW 1 173341709 missense possibly damaging 0.81
R8024:Cadm3 UTSW 1 173338055 missense probably damaging 0.99
R8078:Cadm3 UTSW 1 173341059 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACTAAAGGGCTTCTCTTGTGAAG -3'
(R):5'- CAGAATCTGAAGGGTCCAGAC -3'

Sequencing Primer
(F):5'- AGCCTTGCTTGCTGCCTTG -3'
(R):5'- ATCTGAAGGGTCCAGACAATATC -3'
Posted On2019-11-26